Mutagenetix > Incidental Mutations

Incidental Mutation 'R1489:Duox2'

163585

Institutional Source

Beutler Lab

Gene Symbol

Duox2

Ensembl Gene

ENSMUSG00000068452

Gene Name

dual oxidase 2

Synonyms

A430065P05Rik

MMRRC Submission

039541-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1489 (G1)

Quality Score

213

Status

Validated

Chromosome

Chromosomal Location

122279247-122298165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 122293396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 436 (M436L)

Ref Sequence

ENSEMBL: ENSMUSP00000050314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053734]

AlphaFold

A0A494BAW1

Predicted Effect

probably benign
Transcript: ENSMUST00000053734
AA Change: M436L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: M436L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:An_peroxidase	35	560	5e-131	PFAM
transmembrane domain	600	622	N/A	INTRINSIC
EFh	823	851	3.7e-5	SMART
EFh	859	887	2.09e-4	SMART
transmembrane domain	1010	1032	N/A	INTRINSIC
Pfam:Ferric_reduct	1053	1202	1.8e-22	PFAM
Pfam:FAD_binding_8	1238	1340	3.1e-20	PFAM
Pfam:NAD_binding_6	1346	1500	1.5e-33	PFAM

Meta Mutation Damage Score

0.0933

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Duox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Duox2	APN	2	122283575	missense	probably benign
IGL00790:Duox2	APN	2	122292300	missense	possibly damaging	0.63
IGL01346:Duox2	APN	2	122287202	splice site	probably benign
IGL01607:Duox2	APN	2	122292319	missense	probably benign	0.00
IGL01798:Duox2	APN	2	122281908	missense	probably damaging	1.00
IGL02000:Duox2	APN	2	122290709	missense	probably benign
IGL02219:Duox2	APN	2	122294664	missense	probably benign	0.01
IGL02227:Duox2	APN	2	122285153	splice site	probably benign
IGL02276:Duox2	APN	2	122294085	missense	probably benign	0.00
IGL02447:Duox2	APN	2	122297468	missense	probably damaging	0.98
IGL02806:Duox2	APN	2	122284666	missense	probably damaging	1.00
IGL03091:Duox2	APN	2	122289474	missense	probably benign	0.03
Bedazzled	UTSW	2	122287121	missense	possibly damaging	0.76
Birthday	UTSW	2	122281871	missense	probably benign
gregorian	UTSW	2	122289345	nonsense	probably null
julian	UTSW	2	122289332	missense	probably benign	0.08
mayan	UTSW	2	122284583	missense	probably benign	0.00
minor	UTSW	2	122281496	missense	probably damaging	1.00
oaf	UTSW	2	122295176	missense	probably damaging	0.98
paltry	UTSW	2	122283060	critical splice donor site	probably null
promethius	UTSW	2	122296381	missense	probably benign
Recruit	UTSW	2	122283897	missense	possibly damaging	0.83
schlemiel	UTSW	2	122289563	missense	probably null	0.89
stumblebum	UTSW	2	122284667	missense	probably damaging	1.00
Two-bit	UTSW	2	122281002	missense	probably benign	0.42
R0049:Duox2	UTSW	2	122296686	missense	possibly damaging	0.48
R0244:Duox2	UTSW	2	122291860	missense	probably benign	0.00
R0281:Duox2	UTSW	2	122292304	missense	probably benign	0.10
R0378:Duox2	UTSW	2	122284583	missense	probably benign	0.00
R0383:Duox2	UTSW	2	122291810	critical splice donor site	probably null
R0442:Duox2	UTSW	2	122289332	missense	probably benign	0.08
R0524:Duox2	UTSW	2	122281836	missense	possibly damaging	0.80
R0560:Duox2	UTSW	2	122291554	missense	probably benign	0.04
R0562:Duox2	UTSW	2	122289599	missense	probably damaging	1.00
R0645:Duox2	UTSW	2	122292658	missense	probably damaging	1.00
R0704:Duox2	UTSW	2	122284768	missense	probably benign	0.01
R0963:Duox2	UTSW	2	122287172	missense	probably benign	0.03
R1254:Duox2	UTSW	2	122283478	missense	probably damaging	1.00
R1442:Duox2	UTSW	2	122281751	missense	probably benign	0.20
R1473:Duox2	UTSW	2	122287121	missense	possibly damaging	0.76
R1738:Duox2	UTSW	2	122293414	missense	probably damaging	1.00
R1748:Duox2	UTSW	2	122287051	missense	probably benign	0.00
R1809:Duox2	UTSW	2	122283897	missense	possibly damaging	0.83
R1843:Duox2	UTSW	2	122292258	critical splice donor site	probably null
R1903:Duox2	UTSW	2	122295351	missense	probably damaging	1.00
R1962:Duox2	UTSW	2	122297372	splice site	probably null
R2069:Duox2	UTSW	2	122287108	missense	probably benign	0.01
R2073:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2074:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2075:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2085:Duox2	UTSW	2	122280967	missense	probably damaging	1.00
R3123:Duox2	UTSW	2	122281073	splice site	probably benign
R3907:Duox2	UTSW	2	122283060	critical splice donor site	probably null
R4572:Duox2	UTSW	2	122281726	missense	probably benign	0.00
R4614:Duox2	UTSW	2	122289557	missense	probably damaging	1.00
R4675:Duox2	UTSW	2	122280933	missense	probably damaging	1.00
R4770:Duox2	UTSW	2	122284916	missense	probably benign	0.01
R4817:Duox2	UTSW	2	122296515	missense	probably damaging	0.98
R4931:Duox2	UTSW	2	122296755	missense	probably benign	0.01
R5138:Duox2	UTSW	2	122297531	missense	probably damaging	1.00
R5288:Duox2	UTSW	2	122295136	missense	probably benign
R5344:Duox2	UTSW	2	122281871	missense	probably benign
R5385:Duox2	UTSW	2	122295136	missense	probably benign
R5386:Duox2	UTSW	2	122295136	missense	probably benign
R5493:Duox2	UTSW	2	122281496	missense	probably damaging	1.00
R5632:Duox2	UTSW	2	122281455	missense	probably damaging	1.00
R5742:Duox2	UTSW	2	122284921	missense	probably benign	0.00
R6228:Duox2	UTSW	2	122287193	missense	probably benign	0.38
R6380:Duox2	UTSW	2	122281002	missense	probably benign	0.42
R6398:Duox2	UTSW	2	122296370	missense	probably benign	0.06
R6409:Duox2	UTSW	2	122284667	missense	probably damaging	1.00
R6527:Duox2	UTSW	2	122294614	missense	probably benign	0.29
R6596:Duox2	UTSW	2	122285338	missense	probably benign
R6719:Duox2	UTSW	2	122284386	splice site	probably null
R6981:Duox2	UTSW	2	122291227	missense	possibly damaging	0.95
R7036:Duox2	UTSW	2	122280453	missense	probably damaging	1.00
R7073:Duox2	UTSW	2	122289307	missense	probably damaging	1.00
R7105:Duox2	UTSW	2	122289552	missense	possibly damaging	0.93
R7127:Duox2	UTSW	2	122291949	missense	probably benign	0.02
R7259:Duox2	UTSW	2	122295176	missense	probably damaging	0.98
R7698:Duox2	UTSW	2	122280764	missense	probably damaging	1.00
R7999:Duox2	UTSW	2	122283467	missense	probably benign	0.00
R8103:Duox2	UTSW	2	122287054	missense	probably benign
R8231:Duox2	UTSW	2	122289563	missense	possibly damaging	0.55
R8439:Duox2	UTSW	2	122298155	missense	probably benign
R8712:Duox2	UTSW	2	122289345	nonsense	probably null
R8887:Duox2	UTSW	2	122289563	missense	probably null	0.89
R8909:Duox2	UTSW	2	122296381	missense	probably benign
R9022:Duox2	UTSW	2	122280438	makesense	probably null
R9350:Duox2	UTSW	2	122285248	nonsense	probably null
Z1176:Duox2	UTSW	2	122296507	missense	probably damaging	1.00
Z1177:Duox2	UTSW	2	122293452	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGGAGCATCATGGAAGGTAACGAA -3'
(R):5'- TCATGTAGAGGAGTGCTGGGGAC -3'

Sequencing Primer
(F):5'- agtcctatctctgcctccc -3'
(R):5'- CTGGGGCTGAGGAGAGC -3'

Posted On

2014-03-28