Incidental Mutation 'R1489:Zswim3'
ID163587
Institutional Source Beutler Lab
Gene Symbol Zswim3
Ensembl Gene ENSMUSG00000045822
Gene Namezinc finger SWIM-type containing 3
Synonyms4921517A06Rik
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164805098-164822130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164819981 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000050970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017908] [ENSMUST00000052107] [ENSMUST00000132282]
Predicted Effect probably benign
Transcript: ENSMUST00000017908
SMART Domains Protein: ENSMUSP00000017908
Gene: ENSMUSG00000017764

DomainStartEndE-ValueType
Pfam:SWIM 342 375 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052107
AA Change: V127A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050970
Gene: ENSMUSG00000045822
AA Change: V127A

DomainStartEndE-ValueType
low complexity region 436 453 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
ZnF_PMZ 546 573 2.09e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132282
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Other mutations in Zswim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Zswim3 APN 2 164821091 missense probably damaging 1.00
IGL01345:Zswim3 APN 2 164820137 missense probably damaging 1.00
IGL01608:Zswim3 APN 2 164821520 missense probably damaging 1.00
IGL01621:Zswim3 APN 2 164821520 missense probably damaging 1.00
IGL01634:Zswim3 APN 2 164820002 missense probably damaging 0.99
IGL02165:Zswim3 APN 2 164821115 missense possibly damaging 0.94
IGL02173:Zswim3 APN 2 164820839 missense probably damaging 1.00
IGL02336:Zswim3 APN 2 164820377 missense probably damaging 0.98
IGL02379:Zswim3 APN 2 164820682 unclassified probably null
R0321:Zswim3 UTSW 2 164820359 missense possibly damaging 0.83
R2126:Zswim3 UTSW 2 164819993 missense probably benign 0.31
R2176:Zswim3 UTSW 2 164820694 missense probably benign 0.08
R2859:Zswim3 UTSW 2 164820389 missense probably damaging 1.00
R3853:Zswim3 UTSW 2 164820857 missense possibly damaging 0.61
R4434:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4435:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4436:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4438:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4805:Zswim3 UTSW 2 164820179 missense possibly damaging 0.52
R5874:Zswim3 UTSW 2 164820112 missense probably benign 0.06
R6417:Zswim3 UTSW 2 164820733 missense probably damaging 0.97
R6420:Zswim3 UTSW 2 164820733 missense probably damaging 0.97
R6722:Zswim3 UTSW 2 164820624 unclassified probably null
R6786:Zswim3 UTSW 2 164820851 missense probably damaging 1.00
R7266:Zswim3 UTSW 2 164820482 missense probably benign 0.41
R7467:Zswim3 UTSW 2 164819875 missense possibly damaging 0.59
R7487:Zswim3 UTSW 2 164820215 missense probably damaging 0.99
R7788:Zswim3 UTSW 2 164819779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTATCTGCTGCTGCAATACAAC -3'
(R):5'- AACAGGTCACTCATCTTGCTGCTC -3'

Sequencing Primer
(F):5'- ATACAACGAGACTCTAGATAGACTG -3'
(R):5'- CTGCTCTGGAAGCTGAGTC -3'
Posted On2014-03-28