Mutagenetix > Incidental Mutations

Incidental Mutation 'R1489:Virma'

163589

Institutional Source

Beutler Lab

Gene Symbol

Virma

Ensembl Gene

ENSMUSG00000040720

Gene Name

vir like m6A methyltransferase associated

Synonyms

1110037F02Rik

MMRRC Submission

039541-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11485958-11550684 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11521164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 907 (V907A)

Ref Sequence

ENSEMBL: ENSMUSP00000103943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]

AlphaFold

A2AIV2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055372
AA Change: V857A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720
AA Change: V857A

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059914
AA Change: V857A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: V857A

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1224	1232	N/A	INTRINSIC
low complexity region	1443	1458	N/A	INTRINSIC
low complexity region	1460	1474	N/A	INTRINSIC
low complexity region	1618	1634	N/A	INTRINSIC
low complexity region	1684	1697	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
low complexity region	1796	1808	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108307
AA Change: V907A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: V907A

Domain	Start	End	E-Value	Type
Pfam:VIR_N	5	266	2e-110	PFAM
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1058	1070	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1274	1282	N/A	INTRINSIC
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1668	1684	N/A	INTRINSIC
low complexity region	1734	1747	N/A	INTRINSIC
low complexity region	1800	1807	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Meta Mutation Damage Score

0.1090

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Virma

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Virma	APN	4	11519424	splice site	probably benign
IGL00477:Virma	APN	4	11519006	missense	probably damaging	0.99
IGL01293:Virma	APN	4	11521114	missense	probably damaging	1.00
IGL01410:Virma	APN	4	11518929	nonsense	probably null
IGL01531:Virma	APN	4	11528753	missense	probably damaging	1.00
IGL01672:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL01724:Virma	APN	4	11528672	missense	probably damaging	1.00
IGL01747:Virma	APN	4	11526877	missense	probably damaging	1.00
IGL01776:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL02064:Virma	APN	4	11513163	missense	possibly damaging	0.87
IGL02243:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02244:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02445:Virma	APN	4	11527029	missense	probably damaging	0.97
IGL02546:Virma	APN	4	11494804	missense	probably damaging	0.99
IGL02807:Virma	APN	4	11507079	splice site	probably benign
IGL02967:Virma	APN	4	11514096	missense	probably benign	0.01
IGL03211:Virma	APN	4	11548770	nonsense	probably null
IGL03242:Virma	APN	4	11527669	missense	possibly damaging	0.70
IGL03256:Virma	APN	4	11542207	splice site	probably benign
IGL03327:Virma	APN	4	11518984	missense	probably benign	0.00
IGL03346:Virma	APN	4	11518984	missense	probably benign	0.00
PIT4802001:Virma	UTSW	4	11546008	missense	probably damaging	0.99
R0142:Virma	UTSW	4	11548783	missense	probably benign	0.04
R0355:Virma	UTSW	4	11528626	nonsense	probably null
R0522:Virma	UTSW	4	11519416	critical splice donor site	probably null
R0600:Virma	UTSW	4	11498769	missense	probably damaging	0.99
R1435:Virma	UTSW	4	11528621	missense	probably damaging	1.00
R1568:Virma	UTSW	4	11528776	missense	probably damaging	0.99
R1616:Virma	UTSW	4	11544954	missense	probably damaging	1.00
R1655:Virma	UTSW	4	11494786	missense	probably damaging	1.00
R1695:Virma	UTSW	4	11494814	missense	probably damaging	0.98
R1835:Virma	UTSW	4	11540511	missense	probably benign	0.02
R1951:Virma	UTSW	4	11513907	missense	probably benign	0.00
R1991:Virma	UTSW	4	11519242	missense	probably benign	0.06
R2145:Virma	UTSW	4	11548726	splice site	probably benign
R2172:Virma	UTSW	4	11527843	missense	possibly damaging	0.82
R2217:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2218:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2248:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R2342:Virma	UTSW	4	11501316	missense	probably damaging	1.00
R3424:Virma	UTSW	4	11513177	nonsense	probably null
R4397:Virma	UTSW	4	11513901	missense	possibly damaging	0.81
R4449:Virma	UTSW	4	11498828	critical splice donor site	probably null
R4660:Virma	UTSW	4	11513505	missense	probably damaging	1.00
R4698:Virma	UTSW	4	11528636	missense	probably damaging	0.99
R4878:Virma	UTSW	4	11544971	missense	probably damaging	1.00
R4937:Virma	UTSW	4	11521147	nonsense	probably null
R5031:Virma	UTSW	4	11542116	nonsense	probably null
R5040:Virma	UTSW	4	11528746	missense	probably benign	0.01
R5061:Virma	UTSW	4	11494840	missense	possibly damaging	0.95
R5091:Virma	UTSW	4	11519392	missense	probably benign	0.00
R5137:Virma	UTSW	4	11546297	missense	probably damaging	1.00
R5262:Virma	UTSW	4	11539926	missense	probably benign	0.01
R5297:Virma	UTSW	4	11494819	missense	probably damaging	1.00
R5730:Virma	UTSW	4	11542154	missense	probably benign	0.44
R5818:Virma	UTSW	4	11513319	missense	possibly damaging	0.92
R5835:Virma	UTSW	4	11514036	missense	probably damaging	1.00
R6125:Virma	UTSW	4	11521172	missense	probably damaging	0.98
R6197:Virma	UTSW	4	11505498	missense	probably damaging	0.96
R6222:Virma	UTSW	4	11527820	missense	probably damaging	1.00
R6793:Virma	UTSW	4	11539968	missense	probably damaging	1.00
R7028:Virma	UTSW	4	11519249	missense	possibly damaging	0.50
R7356:Virma	UTSW	4	11513595	missense	probably damaging	0.99
R7383:Virma	UTSW	4	11514026	missense	probably damaging	0.98
R7391:Virma	UTSW	4	11508099	missense	probably damaging	0.99
R7425:Virma	UTSW	4	11546211	missense	possibly damaging	0.95
R7556:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11549682	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11513016	splice site	probably null
R7986:Virma	UTSW	4	11540023	missense	probably benign	0.01
R7990:Virma	UTSW	4	11513983	missense	probably benign	0.00
R8048:Virma	UTSW	4	11539918	nonsense	probably null
R8050:Virma	UTSW	4	11528643	missense	probably benign	0.22
R8412:Virma	UTSW	4	11521261	critical splice donor site	probably null
R8544:Virma	UTSW	4	11516949	missense	probably benign
R8551:Virma	UTSW	4	11513397	missense	probably damaging	1.00
R8699:Virma	UTSW	4	11528678	missense	probably benign	0.04
R8739:Virma	UTSW	4	11540643	critical splice donor site	probably null
R8950:Virma	UTSW	4	11519047	nonsense	probably null
R9015:Virma	UTSW	4	11540494	missense	probably benign	0.27
R9038:Virma	UTSW	4	11526922	missense	possibly damaging	0.93
R9115:Virma	UTSW	4	11498744	missense	probably benign	0.15
R9294:Virma	UTSW	4	11513507	nonsense	probably null
X0020:Virma	UTSW	4	11486055	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCCAAAGTGAAGTGTAagccggg -3'
(R):5'- AGCAACAGTCAGAAGAGTTCAGCC -3'

Sequencing Primer
(F):5'- aagaaagaaagagagagagagagag -3'
(R):5'- GAAGAGTTCAGCCTTTTCTCCTC -3'

Posted On

2014-03-28