Incidental Mutation 'R1489:4930522H14Rik'
ID163591
Institutional Source Beutler Lab
Gene Symbol 4930522H14Rik
Ensembl Gene ENSMUSG00000060491
Gene NameRIKEN cDNA 4930522H14 gene
Synonyms
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109505337-109531297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109505457 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 218 (K218E)
Ref Sequence ENSEMBL: ENSMUSP00000080923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082306] [ENSMUST00000102725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082306
AA Change: K218E

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080923
Gene: ENSMUSG00000060491
AA Change: K218E

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102725
AA Change: K222E

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099786
Gene: ENSMUSG00000060491
AA Change: K222E

DomainStartEndE-ValueType
Pfam:DUF4718 6 190 2.1e-105 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in 4930522H14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0363:4930522H14Rik UTSW 4 109524323 missense probably null
R1460:4930522H14Rik UTSW 4 109531210 critical splice donor site probably null
R1647:4930522H14Rik UTSW 4 109505571 missense probably damaging 0.97
R5481:4930522H14Rik UTSW 4 109505562 missense probably damaging 0.97
R5658:4930522H14Rik UTSW 4 109505447 missense probably damaging 0.99
R6559:4930522H14Rik UTSW 4 109505805 missense possibly damaging 0.70
R7387:4930522H14Rik UTSW 4 109505577 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACATTGAGCCCGCCAATAGGAG -3'
(R):5'- ACTGCTGCCAGACCGTAGAAGAAG -3'

Sequencing Primer
(F):5'- acagacatacatggaggcaag -3'
(R):5'- CCGAAGACTGGCTTACTGATG -3'
Posted On2014-03-28