Incidental Mutation 'R1489:Fndc4'
ID163593
Institutional Source Beutler Lab
Gene Symbol Fndc4
Ensembl Gene ENSMUSG00000038552
Gene Namefibronectin type III domain containing 4
SynonymsFRCP1, 2810430J06Rik, 6330410H20Rik
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31292242-31296080 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 31293451 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 232 (*232W)
Ref Sequence ENSEMBL: ENSMUSP00000127404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041266] [ENSMUST00000041565] [ENSMUST00000072228] [ENSMUST00000172435] [ENSMUST00000201166] [ENSMUST00000201417] [ENSMUST00000201675] [ENSMUST00000201809] [ENSMUST00000202158] [ENSMUST00000202615]
Predicted Effect probably null
Transcript: ENSMUST00000041266
AA Change: *232W
SMART Domains Protein: ENSMUSP00000047185
Gene: ENSMUSG00000038552
AA Change: *232W

DomainStartEndE-ValueType
FN3 43 123 4.35e-11 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041565
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000172435
AA Change: *232W
SMART Domains Protein: ENSMUSP00000127404
Gene: ENSMUSG00000038552
AA Change: *232W

DomainStartEndE-ValueType
FN3 43 123 4.35e-11 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200845
Predicted Effect probably benign
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201274
Predicted Effect probably benign
Transcript: ENSMUST00000201417
SMART Domains Protein: ENSMUSP00000144142
Gene: ENSMUSG00000038552

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
FN3 43 118 9.4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201675
SMART Domains Protein: ENSMUSP00000144568
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 120 7e-64 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201809
SMART Domains Protein: ENSMUSP00000144425
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 3.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201906
Predicted Effect probably benign
Transcript: ENSMUST00000202158
Predicted Effect probably benign
Transcript: ENSMUST00000202615
SMART Domains Protein: ENSMUSP00000144195
Gene: ENSMUSG00000038552

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
FN3 43 123 2.2e-13 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202909
Meta Mutation Damage Score 0.8602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Homozygous knockout mice suffer from increased severity of DSS-induced colitis with increased weight loss and decreased colon length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Fndc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Fndc4 APN 5 31293496 unclassified probably benign
IGL01963:Fndc4 APN 5 31295212 critical splice donor site probably null
IGL02507:Fndc4 APN 5 31294746 missense probably damaging 1.00
IGL02702:Fndc4 APN 5 31293735 missense probably damaging 1.00
IGL02748:Fndc4 APN 5 31294786 missense possibly damaging 0.95
R4085:Fndc4 UTSW 5 31293777 missense probably damaging 0.99
R5418:Fndc4 UTSW 5 31294634 missense probably benign 0.25
R7055:Fndc4 UTSW 5 31294178 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCTGCTTACAGTGGAAAGAGGATG -3'
(R):5'- AGTACCCTGCAAGGCTTCAAGAAC -3'

Sequencing Primer
(F):5'- TCAAGCGGGTCACCATCTTA -3'
(R):5'- GCCGTCAGTATGACATCATCAAG -3'
Posted On2014-03-28