Incidental Mutation 'R1489:Tnnt1'
ID163595
Institutional Source Beutler Lab
Gene Symbol Tnnt1
Ensembl Gene ENSMUSG00000064179
Gene Nametroponin T1, skeletal, slow
SynonymsssTnT, sTnT, Tnt, skeletal muscle slow-twitch TnT
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4504570-4516382 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4507525 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 232 (Y232*)
Ref Sequence ENSEMBL: ENSMUSP00000137198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071798] [ENSMUST00000108587] [ENSMUST00000163538] [ENSMUST00000163710] [ENSMUST00000163722] [ENSMUST00000166161] [ENSMUST00000166268] [ENSMUST00000166959] [ENSMUST00000178163]
Predicted Effect probably null
Transcript: ENSMUST00000071798
AA Change: Y232*
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179
AA Change: Y232*

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086502
Predicted Effect probably null
Transcript: ENSMUST00000108587
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179
AA Change: Y233*

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163538
SMART Domains Protein: ENSMUSP00000127964
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 160 4.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163710
AA Change: Y221*
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179
AA Change: Y221*

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163722
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166161
AA Change: Y220*
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179
AA Change: Y220*

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166268
SMART Domains Protein: ENSMUSP00000128476
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166959
SMART Domains Protein: ENSMUSP00000129109
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 192 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169571
Predicted Effect probably null
Transcript: ENSMUST00000178163
AA Change: Y232*
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179
AA Change: Y232*

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a null or hypomorphic allele show small and loss of type I slow skeletal muscle fibers with compensatory hypertrophy of type II fast fibers and reduced contractile force and tolerance of skeletal muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Tnnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Tnnt1 APN 7 4507550 missense possibly damaging 0.96
IGL01391:Tnnt1 APN 7 4514212 critical splice donor site probably null
IGL01582:Tnnt1 APN 7 4509983 missense probably damaging 1.00
R0098:Tnnt1 UTSW 7 4509045 missense probably damaging 0.99
R0963:Tnnt1 UTSW 7 4507595 missense probably damaging 1.00
R2340:Tnnt1 UTSW 7 4513616 splice site probably benign
R4224:Tnnt1 UTSW 7 4510007 missense probably damaging 1.00
R4624:Tnnt1 UTSW 7 4512268 intron probably benign
R4969:Tnnt1 UTSW 7 4507574 missense probably damaging 1.00
R5245:Tnnt1 UTSW 7 4510067 missense probably damaging 1.00
R5822:Tnnt1 UTSW 7 4516346 nonsense probably null
R6520:Tnnt1 UTSW 7 4509061 nonsense probably null
R6556:Tnnt1 UTSW 7 4509577 missense probably damaging 1.00
R6573:Tnnt1 UTSW 7 4514334 splice site probably null
R6838:Tnnt1 UTSW 7 4507407 missense possibly damaging 0.94
X0010:Tnnt1 UTSW 7 4509971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACAATTTCTGGGCGTGGCTGATG -3'
(R):5'- ACGCACGCACGCACTATGTAAG -3'

Sequencing Primer
(F):5'- GCGGTTGTAGAGCACATTG -3'
(R):5'- acttgctgcatggcttgg -3'
Posted On2014-03-28