Incidental Mutation 'R1489:Ap3b2'
ID 163599
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms beta3B, Naptb
MMRRC Submission 039541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R1489 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 81460399-81493925 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 81463690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 924 (E924*)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
AlphaFold Q9JME5
Predicted Effect probably null
Transcript: ENSMUST00000082090
AA Change: E924*
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: E924*

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147624
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8325:Ap3b2 UTSW 7 81484489 splice site probably null
R8355:Ap3b2 UTSW 7 81473103 missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81473035 missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81477183 missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81463798 missense unknown
R9304:Ap3b2 UTSW 7 81463271 missense unknown
R9321:Ap3b2 UTSW 7 81464504 critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81478009 missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81473903 missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81476344 missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGTGCTCAAAGACCTCCTGCCC -3'
(R):5'- TCTCTAGCTGCTGAGTCCAGTGTC -3'

Sequencing Primer
(F):5'- CCTGCCCTAATAGGAACTTGC -3'
(R):5'- CAGTGTCCAGCATTGGGAG -3'
Posted On 2014-03-28