Incidental Mutation 'R1489:Smpd1'
ID163601
Institutional Source Beutler Lab
Gene Symbol Smpd1
Ensembl Gene ENSMUSG00000037049
Gene Namesphingomyelin phosphodiesterase 1, acid lysosomal
SynonymsASM, aSMase, A-SMase, acid sphingomyelinase, Zn-SMase
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105554360-105558389 bp(+) (GRCm38)
Type of Mutationunclassified (2301 bp from exon)
DNA Base Change (assembly) T to C at 105556554 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]
Predicted Effect probably damaging
Transcript: ENSMUST00000046983
AA Change: I376T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049
AA Change: I376T

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
SapB 85 163 1.05e-7 SMART
low complexity region 177 196 N/A INTRINSIC
Pfam:Metallophos 197 459 4.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081165
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably null
Transcript: ENSMUST00000187057
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably null
Transcript: ENSMUST00000188368
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189378
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191011
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably null
Transcript: ENSMUST00000191601
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211307
Predicted Effect probably null
Transcript: ENSMUST00000211614
Meta Mutation Damage Score 0.9545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
PHENOTYPE: Nullizygous mutations cause tremors, ataxia, altered lipid homeostasis, increased foam cell number, Purkinje cell loss and premature death, and may lead to hepatosplenomegaly, hunched posture, reduced weight, abnormal apoptosis, sperm defects, dyspnea, and high susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Smpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Smpd1 APN 7 105556641 missense probably damaging 0.99
IGL01147:Smpd1 APN 7 105555736 missense probably damaging 1.00
IGL01526:Smpd1 APN 7 105554775 missense probably benign 0.01
IGL01541:Smpd1 APN 7 105555826 missense possibly damaging 0.48
IGL01619:Smpd1 APN 7 105555342 missense possibly damaging 0.89
IGL01924:Smpd1 APN 7 105555448 missense probably benign 0.01
IGL03004:Smpd1 APN 7 105556674 missense possibly damaging 0.82
R0782:Smpd1 UTSW 7 105555343 missense possibly damaging 0.80
R1445:Smpd1 UTSW 7 105556674 missense possibly damaging 0.82
R3683:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3685:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3977:Smpd1 UTSW 7 105555901 missense probably benign 0.29
R4850:Smpd1 UTSW 7 105555985 missense probably benign
R5084:Smpd1 UTSW 7 105556978 missense probably damaging 1.00
R6316:Smpd1 UTSW 7 105555502 missense probably benign 0.19
R6429:Smpd1 UTSW 7 105556928 missense probably damaging 1.00
R6672:Smpd1 UTSW 7 105555273 missense probably benign
R7156:Smpd1 UTSW 7 105554486 unclassified probably benign
X0021:Smpd1 UTSW 7 105557645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGCTCTCAACCCTCTGAGGC -3'
(R):5'- TCTAGGAAGTGAAGCGACACTCCC -3'

Sequencing Primer
(F):5'- CTTTACTGTCAGAGGAGCCC -3'
(R):5'- ACACAGCAGCCTGCTTCTC -3'
Posted On2014-03-28