Mutagenetix > Incidental Mutation

Incidental Mutation 'R1489:Atxn2l'

163602

Institutional Source

Beutler Lab

Gene Symbol

Atxn2l

Ensembl Gene

ENSMUSG00000032637

Gene Name

ataxin 2-like

Synonyms

A2lp, A2D, A2RP, A2LG

MMRRC Submission

039541-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126491708-126503437 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 126496467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 379 (S379T)

Ref Sequence

ENSEMBL: ENSMUSP00000125881 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000179818] [ENSMUST00000206265] [ENSMUST00000206577]

AlphaFold

Q7TQH0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040202
AA Change: S499T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637
AA Change: S499T

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
low complexity region	36	54	N/A	INTRINSIC
low complexity region	56	73	N/A	INTRINSIC
Pfam:SM-ATX	119	189	8.5e-21	PFAM
LsmAD	262	331	1.95e-28	SMART
low complexity region	357	382	N/A	INTRINSIC
low complexity region	450	470	N/A	INTRINSIC
Pfam:PAM2	657	672	5.6e-8	PFAM
low complexity region	681	697	N/A	INTRINSIC
low complexity region	764	787	N/A	INTRINSIC
low complexity region	920	947	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166682
AA Change: S379T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637
AA Change: S379T

Domain	Start	End	E-Value	Type
Pfam:SM-ATX	1	69	1.6e-21	PFAM
LsmAD	142	211	1.95e-28	SMART
low complexity region	237	262	N/A	INTRINSIC
low complexity region	330	350	N/A	INTRINSIC
Pfam:PAM2	537	553	4.3e-8	PFAM
low complexity region	561	577	N/A	INTRINSIC
low complexity region	644	667	N/A	INTRINSIC
low complexity region	800	827	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167759
AA Change: S413T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637
AA Change: S413T

Domain	Start	End	E-Value	Type
Pfam:SM-ATX	33	103	8.1e-23	PFAM
LsmAD	176	245	1.95e-28	SMART
low complexity region	271	296	N/A	INTRINSIC
low complexity region	364	384	N/A	INTRINSIC
Pfam:PAM2	571	587	4.2e-8	PFAM
low complexity region	595	611	N/A	INTRINSIC
low complexity region	678	701	N/A	INTRINSIC
low complexity region	834	861	N/A	INTRINSIC
low complexity region	893	905	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
low complexity region	944	960	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179818

SMART Domains

Protein: ENSMUSP00000137108
Gene: ENSMUSG00000032637

Domain	Start	End	E-Value	Type
Pfam:SM-ATX	62	132	4.3e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000206265

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206577
AA Change: S493T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.0802

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Atxn2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Atxn2l	APN	7	126498288	missense	possibly damaging	0.94
IGL00507:Atxn2l	APN	7	126496584	missense	possibly damaging	0.51
IGL00846:Atxn2l	APN	7	126499178	missense	probably damaging	1.00
IGL01813:Atxn2l	APN	7	126500253	missense	probably damaging	1.00
PIT4378001:Atxn2l	UTSW	7	126497271	missense	probably benign	0.11
R0005:Atxn2l	UTSW	7	126498274	missense	probably damaging	1.00
R0267:Atxn2l	UTSW	7	126493207	missense	probably damaging	1.00
R0608:Atxn2l	UTSW	7	126501416	splice site	probably null
R0749:Atxn2l	UTSW	7	126500837	missense	possibly damaging	0.50
R0831:Atxn2l	UTSW	7	126499160	missense	probably damaging	1.00
R0881:Atxn2l	UTSW	7	126496596	missense	probably damaging	1.00
R1022:Atxn2l	UTSW	7	126497294	missense	probably benign	0.01
R1024:Atxn2l	UTSW	7	126497294	missense	probably benign	0.01
R1081:Atxn2l	UTSW	7	126494212	missense	probably damaging	1.00
R1132:Atxn2l	UTSW	7	126494248	small deletion	probably benign
R1919:Atxn2l	UTSW	7	126493168	missense	probably damaging	0.99
R2062:Atxn2l	UTSW	7	126495866	missense	probably damaging	1.00
R2170:Atxn2l	UTSW	7	126503239	start gained	probably benign
R3719:Atxn2l	UTSW	7	126498130	missense	probably damaging	1.00
R3861:Atxn2l	UTSW	7	126501951	critical splice donor site	probably null
R5061:Atxn2l	UTSW	7	126500203	missense	probably damaging	1.00
R6022:Atxn2l	UTSW	7	126496435	critical splice donor site	probably null
R6075:Atxn2l	UTSW	7	126492517	missense	possibly damaging	0.70
R6131:Atxn2l	UTSW	7	126503165	unclassified	probably benign
R6460:Atxn2l	UTSW	7	126494248	small deletion	probably benign
R6552:Atxn2l	UTSW	7	126493821	missense	possibly damaging	0.70
R7167:Atxn2l	UTSW	7	126499222	missense	possibly damaging	0.76
R7234:Atxn2l	UTSW	7	126493201	missense	probably damaging	1.00
R7301:Atxn2l	UTSW	7	126494211	nonsense	probably null
R7432:Atxn2l	UTSW	7	126493874	missense	possibly damaging	0.46
R7691:Atxn2l	UTSW	7	126492610	critical splice acceptor site	probably null
R7711:Atxn2l	UTSW	7	126501269	missense	probably damaging	1.00
R7849:Atxn2l	UTSW	7	126493173	missense	possibly damaging	0.48
R7870:Atxn2l	UTSW	7	126492752	missense	probably benign
R8907:Atxn2l	UTSW	7	126500253	missense	probably damaging	1.00
R8929:Atxn2l	UTSW	7	126493756	splice site	probably benign
R8949:Atxn2l	UTSW	7	126492205	missense	probably damaging	0.99
R8982:Atxn2l	UTSW	7	126494248	small deletion	probably benign
R9021:Atxn2l	UTSW	7	126495540	missense	probably benign	0.00
R9127:Atxn2l	UTSW	7	126498221	missense	probably damaging	1.00
R9769:Atxn2l	UTSW	7	126496520	missense	probably benign	0.00
RF006:Atxn2l	UTSW	7	126495891	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCCAGTTCTTGGGCTTCCAAATTC -3'
(R):5'- ACTTACCTGCCCTGGGCTTAACAC -3'

Sequencing Primer
(F):5'- GGGCTTCCAAATTCCTACTGG -3'
(R):5'- GCTTAACACAGGAAATTGTGCC -3'

Posted On

2014-03-28