Incidental Mutation 'R1489:Mbd3'
ID 163610
Institutional Source Beutler Lab
Gene Symbol Mbd3
Ensembl Gene ENSMUSG00000035478
Gene Name methyl-CpG binding domain protein 3
Synonyms
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1489 (G1)
Quality Score 216
Status Validated
Chromosome 10
Chromosomal Location 80392539-80399550 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 80393906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Histidine at position 190 (D190H)
Ref Sequence ENSEMBL: ENSMUSP00000100986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092295] [ENSMUST00000105347] [ENSMUST00000105348] [ENSMUST00000105349]
AlphaFold Q9Z2D8
Predicted Effect probably damaging
Transcript: ENSMUST00000092295
AA Change: D222H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089948
Gene: ENSMUSG00000035478
AA Change: D222H

DomainStartEndE-ValueType
MBD 3 76 8.9e-35 SMART
Pfam:MBDa 79 148 8.2e-32 PFAM
Pfam:MBD_C 152 243 4.7e-37 PFAM
low complexity region 268 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105347
AA Change: D198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100984
Gene: ENSMUSG00000035478
AA Change: D198H

DomainStartEndE-ValueType
Pfam:MBD 12 48 4.4e-8 PFAM
Pfam:MBD_C 126 219 9.8e-39 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105348
AA Change: D218H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100985
Gene: ENSMUSG00000035478
AA Change: D218H

DomainStartEndE-ValueType
MBD 1 44 4.8e-6 SMART
Pfam:MBD_C 146 239 1.7e-35 PFAM
low complexity region 264 279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105349
AA Change: D190H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100986
Gene: ENSMUSG00000035478
AA Change: D190H

DomainStartEndE-ValueType
Pfam:MBD 4 40 4.7e-8 PFAM
Pfam:MBD_C 118 211 1.1e-38 PFAM
low complexity region 236 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125618
Predicted Effect unknown
Transcript: ENSMUST00000142997
AA Change: D121H
SMART Domains Protein: ENSMUSP00000120675
Gene: ENSMUSG00000035478
AA Change: D121H

DomainStartEndE-ValueType
Pfam:MBDa 1 48 2.4e-25 PFAM
Pfam:MBD_C 52 143 1.3e-37 PFAM
low complexity region 168 183 N/A INTRINSIC
Meta Mutation Damage Score 0.1544 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a member of the MBD family of nuclear proteins that contain a methyl-CpG binding domain (MBD). The encoded protein is a component of the nucleosome remodeling and histone deacetylation (NuRD) complex. Deletion of this gene causes embryonic lethality in mice. Embryonic stem cells lacking the encoded protein are severely compromised in their ability to differentiate and fail to commit to developmental lineages in the absence of leukemia inhibitory factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience deficiencies as embryos around implantation and die before birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Mbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mbd3 APN 10 80393883 splice site probably benign
IGL01573:Mbd3 APN 10 80393261 missense probably benign 0.03
IGL03080:Mbd3 APN 10 80393251 missense probably damaging 1.00
R1500:Mbd3 UTSW 10 80394586 missense possibly damaging 0.90
R4454:Mbd3 UTSW 10 80393983 missense probably damaging 1.00
R4921:Mbd3 UTSW 10 80395576 missense probably damaging 1.00
R7611:Mbd3 UTSW 10 80395518 missense probably damaging 0.99
R7659:Mbd3 UTSW 10 80395185 missense probably damaging 1.00
X0063:Mbd3 UTSW 10 80395453 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCAGCATTTCTAAGCGTGCC -3'
(R):5'- TGGGATGGGGTCATAACTTCCAGG -3'

Sequencing Primer
(F):5'- CTGTCGGGCATCTAAATTGC -3'
(R):5'- GGTCATAACTTCCAGGTAGAGCC -3'
Posted On 2014-03-28