Mutagenetix > Incidental Mutations

Incidental Mutation 'R1489:Adam6b'

163617

Institutional Source

Beutler Lab

Gene Symbol

Adam6b

Ensembl Gene

ENSMUSG00000051804

Gene Name

a disintegrin and metallopeptidase domain 6B

Synonyms

4930523C11Rik

MMRRC Submission

039541-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113489511-113492057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113491451 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 629 (S629R)

Ref Sequence

ENSEMBL: ENSMUSP00000065529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063317]

Predicted Effect

probably benign
Transcript: ENSMUST00000063317
AA Change: S629R

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000065529
Gene: ENSMUSG00000051804
AA Change: S629R

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	30	167	1.1e-16	PFAM
Pfam:Reprolysin	223	407	1.1e-14	PFAM
DISIN	427	502	9.2e-33	SMART
ACR	503	640	2.74e-60	SMART
transmembrane domain	704	726	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Adam6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adam6b	APN	12	113491393	missense	probably damaging	1.00
IGL00800:Adam6b	APN	12	113490442	missense	probably benign	0.24
IGL01456:Adam6b	APN	12	113491463	missense	probably benign	0.30
IGL02232:Adam6b	APN	12	113491144	missense	probably benign	0.06
IGL03039:Adam6b	APN	12	113490882	missense	probably damaging	1.00
IGL03399:Adam6b	APN	12	113491108	missense	probably damaging	0.97
IGL03412:Adam6b	APN	12	113491770	nonsense	probably null
R0234:Adam6b	UTSW	12	113490610	missense	probably damaging	0.98
R0234:Adam6b	UTSW	12	113490610	missense	probably damaging	0.98
R0373:Adam6b	UTSW	12	113490655	missense	probably benign	0.15
R0402:Adam6b	UTSW	12	113489995	missense	probably damaging	0.96
R0420:Adam6b	UTSW	12	113489994	missense	probably benign	0.02
R0573:Adam6b	UTSW	12	113491658	missense	possibly damaging	0.90
R0884:Adam6b	UTSW	12	113490995	missense	probably damaging	1.00
R1542:Adam6b	UTSW	12	113490939	missense	possibly damaging	0.53
R1591:Adam6b	UTSW	12	113489832	missense	probably benign	0.07
R1596:Adam6b	UTSW	12	113491026	missense	probably damaging	1.00
R1675:Adam6b	UTSW	12	113491044	missense	probably benign	0.00
R1699:Adam6b	UTSW	12	113490585	missense	probably benign	0.02
R1818:Adam6b	UTSW	12	113491256	missense	probably benign	0.15
R1829:Adam6b	UTSW	12	113489925	missense	probably damaging	1.00
R1851:Adam6b	UTSW	12	113491822	missense	probably benign	0.44
R1955:Adam6b	UTSW	12	113491816	missense	probably benign	0.16
R2040:Adam6b	UTSW	12	113490744	missense	probably benign	0.34
R3820:Adam6b	UTSW	12	113490364	missense	probably benign	0.38
R4112:Adam6b	UTSW	12	113489636	missense	possibly damaging	0.85
R4434:Adam6b	UTSW	12	113490661	missense	probably damaging	1.00
R4435:Adam6b	UTSW	12	113490661	missense	probably damaging	1.00
R4437:Adam6b	UTSW	12	113490661	missense	probably damaging	1.00
R4438:Adam6b	UTSW	12	113490661	missense	probably damaging	1.00
R4509:Adam6b	UTSW	12	113490352	missense	probably benign	0.02
R5034:Adam6b	UTSW	12	113490927	missense	probably damaging	1.00
R5316:Adam6b	UTSW	12	113491393	missense	probably damaging	1.00
R5330:Adam6b	UTSW	12	113490580	missense	possibly damaging	0.45
R5331:Adam6b	UTSW	12	113490580	missense	possibly damaging	0.45
R5604:Adam6b	UTSW	12	113490800	nonsense	probably null
R5698:Adam6b	UTSW	12	113491463	missense	probably benign	0.30
R5877:Adam6b	UTSW	12	113490202	missense	probably damaging	1.00
R6235:Adam6b	UTSW	12	113491710	missense	probably benign
R6254:Adam6b	UTSW	12	113489570	missense	probably damaging	0.99
R6371:Adam6b	UTSW	12	113490274	missense	probably damaging	0.99
R6617:Adam6b	UTSW	12	113490532	missense	possibly damaging	0.78
R6768:Adam6b	UTSW	12	113490243	missense	probably benign	0.01
R7002:Adam6b	UTSW	12	113489707	nonsense	probably null
R7003:Adam6b	UTSW	12	113490042	nonsense	probably null
R7049:Adam6b	UTSW	12	113490502	missense	probably damaging	0.99
R7313:Adam6b	UTSW	12	113491134	missense	probably benign	0.00
R7372:Adam6b	UTSW	12	113490164	missense	probably benign	0.24
R7684:Adam6b	UTSW	12	113491576	nonsense	probably null
R7777:Adam6b	UTSW	12	113490138	missense	possibly damaging	0.93
R7781:Adam6b	UTSW	12	113491342	missense	probably damaging	1.00
RF012:Adam6b	UTSW	12	113489932	missense	probably damaging	1.00
RF022:Adam6b	UTSW	12	113491669	missense	possibly damaging	0.90
T0722:Adam6b	UTSW	12	113489577	missense	possibly damaging	0.91
T0722:Adam6b	UTSW	12	113491268	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- TGTGGAAGGTTGCAGTGTACCAATG -3'
(R):5'- CCTACACGAGTGGCAATGCCAAAG -3'

Sequencing Primer
(F):5'- GTTGCAGTGTACCAATGTCACC -3'
(R):5'- aactggaggggacccac -3'

Posted On

2014-03-28