Incidental Mutation 'R1489:Prl'
ID 163619
Institutional Source Beutler Lab
Gene Symbol Prl
Ensembl Gene ENSMUSG00000021342
Gene Name prolactin
Synonyms Prl, Prl1a1
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R1489 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 27057570-27065205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27057636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 3 (S3C)
Ref Sequence ENSEMBL: ENSMUSP00000153245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018061] [ENSMUST00000110369] [ENSMUST00000224228]
AlphaFold P06879
Predicted Effect possibly damaging
Transcript: ENSMUST00000018061
AA Change: S3C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018061
Gene: ENSMUSG00000021342
AA Change: S3C

DomainStartEndE-ValueType
Pfam:Hormone_1 15 225 1.6e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110369
AA Change: S5C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105998
Gene: ENSMUSG00000021342
AA Change: S5C

DomainStartEndE-ValueType
Pfam:Hormone_1 18 228 4.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223686
Predicted Effect probably damaging
Transcript: ENSMUST00000224228
AA Change: S3C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224627
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the anterior pituitary hormone prolactin. This secreted hormone is a growth regulator for many tissues, including cells of the immune system. It may also play a role in cell survival by suppressing apoptosis, and it is essential for lactation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null female mice have irregular oestrus cycles and are infertile. Defects of the pituitary gland include hyperplasia, which progresses to adenoma, and impaired secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Prl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Prl APN 13 27065041 missense possibly damaging 0.93
IGL02514:Prl APN 13 27059394 missense probably damaging 1.00
IGL02638:Prl APN 13 27061579 missense probably benign 0.02
IGL03093:Prl APN 13 27064887 missense probably benign 0.04
R0479:Prl UTSW 13 27064928 missense probably damaging 1.00
R1259:Prl UTSW 13 27061489 splice site probably null
R4392:Prl UTSW 13 27064351 missense possibly damaging 0.83
R5183:Prl UTSW 13 27057596 start gained probably benign
R6623:Prl UTSW 13 27061509 missense probably benign 0.01
R6831:Prl UTSW 13 27059547 missense probably benign 0.01
R6860:Prl UTSW 13 27064959 missense possibly damaging 0.89
R8806:Prl UTSW 13 27059532 missense probably damaging 0.98
R9254:Prl UTSW 13 27059520 missense probably damaging 1.00
R9379:Prl UTSW 13 27059520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTCTCAGCCTCAGCATTTCTC -3'
(R):5'- ACTGACCTCAGCATGGGTAGTCAC -3'

Sequencing Primer
(F):5'- GGCCAATGTCTTCCTGAATATG -3'
(R):5'- CAGCATGGGTAGTCACTCTTAGC -3'
Posted On 2014-03-28