Incidental Mutation 'R1489:Foxc1'
ID 163620
Institutional Source Beutler Lab
Gene Symbol Foxc1
Ensembl Gene ENSMUSG00000050295
Gene Name forkhead box C1
Synonyms frkhda, fkh-1, Mf1, Mf4, FREAC3, Fkh1, fkh1
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1489 (G1)
Quality Score 183
Status Validated
Chromosome 13
Chromosomal Location 31806633-31812476 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 31808612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 469 (R469*)
Ref Sequence ENSEMBL: ENSMUSP00000052196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062292]
AlphaFold Q61572
Predicted Effect probably null
Transcript: ENSMUST00000062292
AA Change: R469*
SMART Domains Protein: ENSMUSP00000052196
Gene: ENSMUSG00000050295
AA Change: R469*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
FH 76 166 4e-64 SMART
low complexity region 169 186 N/A INTRINSIC
low complexity region 193 218 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 261 287 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 323 345 N/A INTRINSIC
low complexity region 352 398 N/A INTRINSIC
low complexity region 415 426 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it has been shown to play a role in the regulation of embryonic and ocular development. Mutations in this gene cause various glaucoma phenotypes including primary congenital glaucoma, autosomal dominant iridogoniodysgenesis anomaly, and Axenfeld-Rieger anomaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are neonatal lethal with congenital hydrocephalus, edema, abnormalities of the eye, skull, axial skeleton, kidney-ureter and cardiovascular systems. Heterozygotes have variable milder defects depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Foxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01859:Foxc1 APN 13 31808723 missense unknown
R0369:Foxc1 UTSW 13 31807512 missense probably damaging 0.99
R1217:Foxc1 UTSW 13 31808685 missense unknown
R1696:Foxc1 UTSW 13 31808799 missense unknown
R1884:Foxc1 UTSW 13 31807665 missense probably damaging 0.98
R2163:Foxc1 UTSW 13 31808603 missense unknown
R2442:Foxc1 UTSW 13 31808798 missense unknown
R4210:Foxc1 UTSW 13 31807707 missense probably damaging 1.00
R5562:Foxc1 UTSW 13 31807590 missense probably damaging 1.00
R5717:Foxc1 UTSW 13 31807488 missense probably benign 0.25
R6865:Foxc1 UTSW 13 31808853 missense unknown
R7289:Foxc1 UTSW 13 31807260 missense probably damaging 1.00
R7397:Foxc1 UTSW 13 31807635 missense probably damaging 0.98
R7469:Foxc1 UTSW 13 31808378 missense unknown
R7469:Foxc1 UTSW 13 31808379 missense unknown
R7763:Foxc1 UTSW 13 31808028 missense probably benign 0.23
R7806:Foxc1 UTSW 13 31808756 missense unknown
R8350:Foxc1 UTSW 13 31807565 nonsense probably null
R8429:Foxc1 UTSW 13 31807776 missense probably benign
R8529:Foxc1 UTSW 13 31808537 missense unknown
R8530:Foxc1 UTSW 13 31807788 missense probably benign 0.00
R8849:Foxc1 UTSW 13 31808834 missense unknown
R8894:Foxc1 UTSW 13 31808222 missense unknown
X0063:Foxc1 UTSW 13 31807556 missense probably benign 0.14
Z1177:Foxc1 UTSW 13 31807308 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCAGCGTGGACAACATCATGACG -3'
(R):5'- GCCGGGAATAGGGTCAGAATTTGC -3'

Sequencing Primer
(F):5'- AGGCTATGAGCCTGTACGC -3'
(R):5'- AGGGTCAGAATTTGCTACAGTC -3'
Posted On 2014-03-28