Mutagenetix > Incidental Mutations

Incidental Mutation 'R1489:Cap2'

163621

Institutional Source

Beutler Lab

Gene Symbol

Cap2

Ensembl Gene

ENSMUSG00000021373

Gene Name

CAP, adenylate cyclase-associated protein, 2 (yeast)

Synonyms

MMRRC Submission

039541-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46501848-46650281 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46609635 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 114 (I114F)

Ref Sequence

ENSEMBL: ENSMUSP00000021802 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021802
AA Change: I114F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: I114F

Domain	Start	End	E-Value	Type
Pfam:CAP_N	5	301	2.6e-117	PFAM
CARP	358	395	1.06e-10	SMART
CARP	396	433	1.12e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119341

SMART Domains

Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

Domain	Start	End	E-Value	Type
Pfam:CAP_N	4	105	1.8e-25	PFAM
Pfam:CAP_N	99	198	8.2e-29	PFAM
CARP	246	283	1.06e-10	SMART
CARP	284	321	1.12e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225040

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225444

Predicted Effect

probably damaging
Transcript: ENSMUST00000225824
AA Change: I59F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.7377

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Cap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01810:Cap2	APN	13	46639949	splice site	probably benign
IGL01927:Cap2	APN	13	46635633	missense	probably benign	0.03
IGL02213:Cap2	APN	13	46635611	splice site	probably benign
IGL02511:Cap2	APN	13	46531022	start codon destroyed	probably null	0.12
IGL02871:Cap2	APN	13	46525492	missense	probably benign	0.00
R0063:Cap2	UTSW	13	46638032	splice site	probably benign
R0063:Cap2	UTSW	13	46638032	splice site	probably benign
R0234:Cap2	UTSW	13	46638022	critical splice donor site	probably null
R0234:Cap2	UTSW	13	46638022	critical splice donor site	probably null
R0385:Cap2	UTSW	13	46560547	missense	probably damaging	1.00
R0387:Cap2	UTSW	13	46560516	missense	probably damaging	0.99
R0712:Cap2	UTSW	13	46615361	splice site	probably null
R1666:Cap2	UTSW	13	46615323	missense	probably damaging	0.98
R1668:Cap2	UTSW	13	46615323	missense	probably damaging	0.98
R1676:Cap2	UTSW	13	46637859	missense	probably damaging	1.00
R1756:Cap2	UTSW	13	46531013	missense	probably benign	0.11
R1822:Cap2	UTSW	13	46615347	missense	probably benign	0.03
R1867:Cap2	UTSW	13	46640079	missense	probably damaging	1.00
R1972:Cap2	UTSW	13	46637899	missense	probably damaging	0.98
R1990:Cap2	UTSW	13	46637881	missense	possibly damaging	0.93
R1991:Cap2	UTSW	13	46637881	missense	possibly damaging	0.93
R1992:Cap2	UTSW	13	46637881	missense	possibly damaging	0.93
R2144:Cap2	UTSW	13	46560502	critical splice acceptor site	probably null
R3039:Cap2	UTSW	13	46639841	missense	probably benign	0.20
R4024:Cap2	UTSW	13	46637841	splice site	probably benign
R4554:Cap2	UTSW	13	46635774	missense	probably damaging	1.00
R4748:Cap2	UTSW	13	46639826	missense	possibly damaging	0.64
R4821:Cap2	UTSW	13	46610110	missense	probably damaging	0.99
R4876:Cap2	UTSW	13	46531021	start codon destroyed	probably null
R4902:Cap2	UTSW	13	46531025	missense	probably damaging	0.99
R5320:Cap2	UTSW	13	46648364	makesense	probably null
R5666:Cap2	UTSW	13	46531083	splice site	probably null
R5670:Cap2	UTSW	13	46531083	splice site	probably null
R6086:Cap2	UTSW	13	46635712	missense	probably damaging	1.00
R6728:Cap2	UTSW	13	46639859	missense	possibly damaging	0.87
R6842:Cap2	UTSW	13	46646625	missense	probably damaging	1.00
R7785:Cap2	UTSW	13	46635748	missense	probably benign
R7889:Cap2	UTSW	13	46646575	missense	probably damaging	0.99
R8065:Cap2	UTSW	13	46637861	missense	probably damaging	1.00
R8205:Cap2	UTSW	13	46615263	missense	probably damaging	1.00
R8425:Cap2	UTSW	13	46609732	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAACCATCCTGCAAGATGGGGCAC -3'
(R):5'- AAGCTGAAGCATCCACCCTGGAAG -3'

Sequencing Primer
(F):5'- ACGTGTTCCTTTCAGACCC -3'
(R):5'- TTCAGTGGACCGAACTACG -3'

Posted On

2014-03-28