Incidental Mutation 'R1489:Cap2'
ID 163621
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 039541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1489 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46763111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 114 (I114F)
Ref Sequence ENSEMBL: ENSMUSP00000021802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: I114F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: I114F

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225444
Predicted Effect probably damaging
Transcript: ENSMUST00000225824
AA Change: I59F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.7377 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,106,295 (GRCm39) S143P possibly damaging Het
4930522H14Rik T C 4: 109,362,654 (GRCm39) K218E possibly damaging Het
Abcb1a T A 5: 8,736,300 (GRCm39) probably null Het
Adam39 A G 8: 41,278,031 (GRCm39) T141A possibly damaging Het
Adam6b T A 12: 113,455,071 (GRCm39) S629R probably benign Het
Ap3b2 C A 7: 81,113,438 (GRCm39) E924* probably null Het
Armc3 A T 2: 19,314,858 (GRCm39) Y856F probably benign Het
Asap1 A G 15: 64,044,579 (GRCm39) L142P probably damaging Het
Atg9a T A 1: 75,162,734 (GRCm39) D427V probably damaging Het
Atl2 G A 17: 80,160,135 (GRCm39) A17V probably benign Het
Atxn2l A T 7: 126,095,639 (GRCm39) S379T probably damaging Het
C1ql3 G T 2: 13,015,453 (GRCm39) P69Q possibly damaging Het
Ccdc168 A G 1: 44,096,950 (GRCm39) F1383L probably benign Het
Ccdc168 T C 1: 44,100,667 (GRCm39) I144V probably benign Het
Cox16 T C 12: 81,521,389 (GRCm39) N135S probably null Het
Dnajc13 A T 9: 104,108,234 (GRCm39) H180Q possibly damaging Het
Dpy19l3 A T 7: 35,424,835 (GRCm39) Y73* probably null Het
Duox2 T A 2: 122,123,877 (GRCm39) M436L probably benign Het
Exoc6 T A 19: 37,585,568 (GRCm39) M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,702,829 (GRCm39) probably benign Het
Fmn1 T A 2: 113,195,557 (GRCm39) V419E unknown Het
Fndc4 T C 5: 31,450,795 (GRCm39) *232W probably null Het
Foxc1 C T 13: 31,992,595 (GRCm39) R469* probably null Het
Fsip2 A G 2: 82,810,155 (GRCm39) H2158R probably benign Het
Ghdc C T 11: 100,659,083 (GRCm39) G373D probably benign Het
Gm10330 A T 12: 23,830,032 (GRCm39) S50T probably benign Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Lonrf1 A G 8: 36,690,108 (GRCm39) V650A probably damaging Het
Map1a T C 2: 121,130,918 (GRCm39) V578A possibly damaging Het
Mbd3 C G 10: 80,229,740 (GRCm39) D190H probably damaging Het
Mcpt9 T C 14: 56,264,976 (GRCm39) K175R probably benign Het
Mia3 A G 1: 183,120,121 (GRCm39) S85P probably benign Het
Myrip T C 9: 120,261,595 (GRCm39) F403L probably damaging Het
Nox4 A G 7: 86,954,097 (GRCm39) Y134C probably damaging Het
Numb A G 12: 83,842,217 (GRCm39) L642P probably damaging Het
Pappa A T 4: 65,099,185 (GRCm39) Y568F possibly damaging Het
Pdzrn4 T C 15: 92,575,593 (GRCm39) L333P probably benign Het
Prl A T 13: 27,241,619 (GRCm39) S3C probably damaging Het
Ptprc T C 1: 138,047,824 (GRCm39) T60A possibly damaging Het
Rbm10 C T X: 20,503,903 (GRCm39) probably benign Het
Slc7a7 C T 14: 54,646,103 (GRCm39) R120H probably damaging Het
Smpd1 T C 7: 105,205,761 (GRCm39) probably null Het
Spta1 A G 1: 174,058,891 (GRCm39) E1942G probably damaging Het
Tmem38a A G 8: 73,333,479 (GRCm39) Y66C probably damaging Het
Tnnt1 A T 7: 4,510,524 (GRCm39) Y232* probably null Het
Tpte T C 8: 22,839,405 (GRCm39) probably null Het
Virma T C 4: 11,521,164 (GRCm39) V907A probably damaging Het
Vmn1r174 C T 7: 23,453,981 (GRCm39) Q216* probably null Het
Zswim3 T C 2: 164,661,901 (GRCm39) V127A probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCATCCTGCAAGATGGGGCAC -3'
(R):5'- AAGCTGAAGCATCCACCCTGGAAG -3'

Sequencing Primer
(F):5'- ACGTGTTCCTTTCAGACCC -3'
(R):5'- TTCAGTGGACCGAACTACG -3'
Posted On 2014-03-28