Incidental Mutation 'R1489:Slc7a7'
ID 163622
Institutional Source Beutler Lab
Gene Symbol Slc7a7
Ensembl Gene ENSMUSG00000000958
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonyms my+lat1
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1489 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 54369442-54417780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54408646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 120 (R120H)
Ref Sequence ENSEMBL: ENSMUSP00000154352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000984] [ENSMUST00000195970] [ENSMUST00000195999] [ENSMUST00000196215] [ENSMUST00000197440] [ENSMUST00000200545] [ENSMUST00000226753] [ENSMUST00000227334] [ENSMUST00000227967] [ENSMUST00000228488]
AlphaFold Q9Z1K8
Predicted Effect probably damaging
Transcript: ENSMUST00000000984
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000984
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195970
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143091
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 462 6.4e-66 PFAM
Pfam:AA_permease 43 467 5.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195999
Predicted Effect probably benign
Transcript: ENSMUST00000196215
SMART Domains Protein: ENSMUSP00000142710
Gene: ENSMUSG00000000958

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197440
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143743
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200545
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142587
Gene: ENSMUSG00000000958
AA Change: R120H

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 36 183 7.5e-5 PFAM
Pfam:AA_permease_2 38 186 4.3e-19 PFAM
Pfam:AA_permease 43 185 2.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226753
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227334
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227967
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228488
AA Change: R120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice exhibit fetal growth retardation and often die neonatally. After heavy protein ingestion, surviving adults show a metabolic derangement akin to lysinuric protein intolerance and including a lasting postnatal growth retardation, splenomegaly, hyperammonemia, and aminoaciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Slc7a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R0331:Slc7a7 UTSW 14 54377924 unclassified probably benign
R0608:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R1311:Slc7a7 UTSW 14 54373030 nonsense probably null
R1490:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R4049:Slc7a7 UTSW 14 54373091 critical splice acceptor site probably null
R4731:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4732:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4733:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R5562:Slc7a7 UTSW 14 54408812 missense probably benign
R5745:Slc7a7 UTSW 14 54377835 missense possibly damaging 0.46
R5907:Slc7a7 UTSW 14 54379103 missense probably damaging 1.00
R6140:Slc7a7 UTSW 14 54379058 missense probably damaging 1.00
R6366:Slc7a7 UTSW 14 54374600 missense probably damaging 1.00
R6696:Slc7a7 UTSW 14 54377761 splice site probably null
R6776:Slc7a7 UTSW 14 54374651 missense possibly damaging 0.95
R7310:Slc7a7 UTSW 14 54379025 missense probably damaging 0.99
R7399:Slc7a7 UTSW 14 54374268 missense possibly damaging 0.87
R7903:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
R8679:Slc7a7 UTSW 14 54372992 missense probably benign 0.31
R8888:Slc7a7 UTSW 14 54369836 missense probably benign
R8895:Slc7a7 UTSW 14 54369836 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACTTACAGATGCAGGCAGCGG -3'
(R):5'- TCAACAGCACCAAGTATGAAGTGGC -3'

Sequencing Primer
(F):5'- TAGTTGGCAAAGGTGATGGC -3'
(R):5'- AGATCTCCCTGCTTAATGGCG -3'
Posted On 2014-03-28