Mutagenetix > Incidental Mutations

Incidental Mutation 'R1489:Pdzrn4'

163626

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

039541-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92677712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 333 (L333P)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: L94P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: L94P

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: L333P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: L333P

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229173

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Exoc6	T	A	19: 37,597,120	M481K	possibly damaging	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCTTTTCGAACTGCCAAGGAGCC -3'
(R):5'- AGTCACCTTCCCCTGAGCCTTAATG -3'

Sequencing Primer
(F):5'- CCCATAGTGGTACAGGTGTTAAG -3'
(R):5'- CTGACTAGTAGTCTGAGCCTTGAAG -3'

Posted On

2014-03-28