Incidental Mutation 'R1489:Atl2'
ID 163627
Institutional Source Beutler Lab
Gene Symbol Atl2
Ensembl Gene ENSMUSG00000059811
Gene Name atlastin GTPase 2
Synonyms 2010110I21Rik, Aip-2, Arl6ip2
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1489 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 79848390-79896123 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79852706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 17 (A17V)
Ref Sequence ENSEMBL: ENSMUSP00000152866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068282] [ENSMUST00000112437] [ENSMUST00000222193] [ENSMUST00000222415]
AlphaFold Q6PA06
Predicted Effect probably benign
Transcript: ENSMUST00000068282
AA Change: A484V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064758
Gene: ENSMUSG00000059811
AA Change: A484V

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Pfam:GBP 70 341 3.9e-105 PFAM
low complexity region 377 390 N/A INTRINSIC
Blast:HAMP 495 545 4e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112437
AA Change: A313V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108056
Gene: ENSMUSG00000059811
AA Change: A313V

DomainStartEndE-ValueType
Pfam:GBP 1 170 6.6e-69 PFAM
Pfam:GBP_C 172 302 2.7e-8 PFAM
Blast:HAMP 324 374 3e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221666
Predicted Effect probably benign
Transcript: ENSMUST00000222193
Predicted Effect probably benign
Transcript: ENSMUST00000222415
AA Change: A17V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223273
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Atl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Atl2 APN 17 79859785 critical splice donor site probably null
IGL02692:Atl2 APN 17 79865053 missense probably benign
IGL03127:Atl2 APN 17 79852854 missense probably damaging 0.99
IGL03377:Atl2 APN 17 79865090 missense probably damaging 1.00
R0164:Atl2 UTSW 17 79853831 unclassified probably benign
R1203:Atl2 UTSW 17 79852905 missense probably damaging 0.99
R1663:Atl2 UTSW 17 79864711 missense probably damaging 1.00
R1977:Atl2 UTSW 17 79852590 missense probably damaging 1.00
R2032:Atl2 UTSW 17 79895944 missense probably benign
R4063:Atl2 UTSW 17 79850159 makesense probably null
R5104:Atl2 UTSW 17 79852617 missense probably benign 0.01
R5201:Atl2 UTSW 17 79865151 missense probably benign
R5362:Atl2 UTSW 17 79861461 missense probably damaging 1.00
R5387:Atl2 UTSW 17 79852800 missense probably benign 0.03
R6128:Atl2 UTSW 17 79865041 critical splice donor site probably null
R6369:Atl2 UTSW 17 79854555 missense probably damaging 0.96
R6416:Atl2 UTSW 17 79850223 missense probably benign 0.00
R6597:Atl2 UTSW 17 79852766 missense possibly damaging 0.68
R6885:Atl2 UTSW 17 79852553 missense probably damaging 1.00
R7428:Atl2 UTSW 17 79875798 splice site probably null
R7587:Atl2 UTSW 17 79865067 missense probably benign 0.25
R7646:Atl2 UTSW 17 79854607 missense probably damaging 1.00
R7781:Atl2 UTSW 17 79859831 missense probably damaging 1.00
R7949:Atl2 UTSW 17 79859860 missense probably damaging 1.00
R8170:Atl2 UTSW 17 79856261 missense possibly damaging 0.95
R8313:Atl2 UTSW 17 79852604 nonsense probably null
R8878:Atl2 UTSW 17 79852803 missense probably benign 0.05
R8899:Atl2 UTSW 17 79876040 missense probably benign 0.01
R9335:Atl2 UTSW 17 79852778 missense probably benign 0.00
X0052:Atl2 UTSW 17 79852617 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTCACCGTCTGGCATAATCACC -3'
(R):5'- GTGGCGCTCAAACAGTTTCGTTC -3'

Sequencing Primer
(F):5'- CCAGGCTTTTAAGTAAGAACTAACC -3'
(R):5'- CGTTCTGTGAAAAAAATGGGTGG -3'
Posted On 2014-03-28