Mutagenetix > Incidental Mutation

Incidental Mutation 'R1489:Exoc6'

163629

Institutional Source

Beutler Lab

Gene Symbol

Exoc6

Ensembl Gene

ENSMUSG00000053799

Gene Name

exocyst complex component 6

Synonyms

msec15, Sec15l1, 4833405E05Rik, Sec15, hbd

MMRRC Submission

039541-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37550418-37683245 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37597120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 481 (M481K)

Ref Sequence

ENSEMBL: ENSMUSP00000064332 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066439]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066439
AA Change: M481K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: M481K

Domain	Start	End	E-Value	Type
low complexity region	265	273	N/A	INTRINSIC
Pfam:Sec15	456	762	8.1e-109	PFAM

Meta Mutation Damage Score

0.1264

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	G	12: 55,059,510	S143P	possibly damaging	Het
4930522H14Rik	T	C	4: 109,505,457	K218E	possibly damaging	Het
Abcb1a	T	A	5: 8,686,300		probably null	Het
Adam39	A	G	8: 40,824,994	T141A	possibly damaging	Het
Adam6b	T	A	12: 113,491,451	S629R	probably benign	Het
Ap3b2	C	A	7: 81,463,690	E924*	probably null	Het
Armc3	A	T	2: 19,310,047	Y856F	probably benign	Het
Asap1	A	G	15: 64,172,730	L142P	probably damaging	Het
Atg9a	T	A	1: 75,186,090	D427V	probably damaging	Het
Atl2	G	A	17: 79,852,706	A17V	probably benign	Het
Atxn2l	A	T	7: 126,496,467	S379T	probably damaging	Het
C1ql3	G	T	2: 13,010,642	P69Q	possibly damaging	Het
Cap2	A	T	13: 46,609,635	I114F	probably damaging	Het
Cox16	T	C	12: 81,474,615	N135S	probably null	Het
Dnajc13	A	T	9: 104,231,035	H180Q	possibly damaging	Het
Dpy19l3	A	T	7: 35,725,410	Y73*	probably null	Het
Duox2	T	A	2: 122,293,396	M436L	probably benign	Het
Fbxw2	GCCCCC	GCCCCCCCC	2: 34,812,817		probably benign	Het
Fmn1	T	A	2: 113,365,212	V419E	unknown	Het
Fndc4	T	C	5: 31,293,451	*232W	probably null	Het
Foxc1	C	T	13: 31,808,612	R469*	probably null	Het
Fsip2	A	G	2: 82,979,811	H2158R	probably benign	Het
Ghdc	C	T	11: 100,768,257	G373D	probably benign	Het
Gm10330	A	T	12: 23,780,031	S50T	probably benign	Het
Gm8251	A	G	1: 44,057,790	F1383L	probably benign	Het
Gm8251	T	C	1: 44,061,507	I144V	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Lonrf1	A	G	8: 36,222,954	V650A	probably damaging	Het
Map1a	T	C	2: 121,300,437	V578A	possibly damaging	Het
Mbd3	C	G	10: 80,393,906	D190H	probably damaging	Het
Mcpt9	T	C	14: 56,027,519	K175R	probably benign	Het
Mia3	A	G	1: 183,338,674	S85P	probably benign	Het
Myrip	T	C	9: 120,432,529	F403L	probably damaging	Het
Nox4	A	G	7: 87,304,889	Y134C	probably damaging	Het
Numb	A	G	12: 83,795,443	L642P	probably damaging	Het
Pappa	A	T	4: 65,180,948	Y568F	possibly damaging	Het
Pdzrn4	T	C	15: 92,677,712	L333P	probably benign	Het
Prl	A	T	13: 27,057,636	S3C	probably damaging	Het
Ptprc	T	C	1: 138,120,086	T60A	possibly damaging	Het
Rbm10	C	T	X: 20,637,664		probably benign	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Smpd1	T	C	7: 105,556,554		probably null	Het
Spta1	A	G	1: 174,231,325	E1942G	probably damaging	Het
Tmem38a	A	G	8: 72,579,635	Y66C	probably damaging	Het
Tnnt1	A	T	7: 4,507,525	Y232*	probably null	Het
Tpte	T	C	8: 22,349,389		probably null	Het
Virma	T	C	4: 11,521,164	V907A	probably damaging	Het
Vmn1r174	C	T	7: 23,754,556	Q216*	probably null	Het
Zswim3	T	C	2: 164,819,981	V127A	probably benign	Het

Other mutations in Exoc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Exoc6	APN	19	37589876	missense	possibly damaging	0.68
IGL01716:Exoc6	APN	19	37682964	missense	probably damaging	0.98
IGL02363:Exoc6	APN	19	37608954	missense	probably damaging	1.00
IGL02383:Exoc6	APN	19	37578474	missense	probably benign
IGL03394:Exoc6	APN	19	37599572	missense	probably benign	0.15
australamerican	UTSW	19	37598679	critical splice donor site	probably null
IGL03046:Exoc6	UTSW	19	37593769	critical splice donor site	probably null
R1156:Exoc6	UTSW	19	37682897	missense	probably benign	0.05
R1747:Exoc6	UTSW	19	37639769	splice site	probably null
R2125:Exoc6	UTSW	19	37590941	missense	probably damaging	1.00
R2863:Exoc6	UTSW	19	37653413	missense	probably benign	0.34
R4090:Exoc6	UTSW	19	37571912	missense	probably benign
R4666:Exoc6	UTSW	19	37570505	missense	probably damaging	0.97
R4674:Exoc6	UTSW	19	37609082	missense	probably damaging	1.00
R5382:Exoc6	UTSW	19	37598679	critical splice donor site	probably null
R5471:Exoc6	UTSW	19	37599617	missense	probably benign	0.30
R5533:Exoc6	UTSW	19	37593770	splice site	probably null
R5607:Exoc6	UTSW	19	37578529	missense	probably benign	0.01
R5641:Exoc6	UTSW	19	37587633	splice site	probably null
R5759:Exoc6	UTSW	19	37573741	nonsense	probably null
R5889:Exoc6	UTSW	19	37582245	missense	probably damaging	1.00
R6592:Exoc6	UTSW	19	37571912	missense	probably benign
R6936:Exoc6	UTSW	19	37571863	missense	probably benign	0.00
R6988:Exoc6	UTSW	19	37609091	missense	probably damaging	1.00
R7088:Exoc6	UTSW	19	37577010	missense	probably damaging	0.99
R7162:Exoc6	UTSW	19	37577118	missense	probably damaging	0.97
R7948:Exoc6	UTSW	19	37576974	missense	probably benign	0.00
R8266:Exoc6	UTSW	19	37577049	missense	probably benign	0.00
R8525:Exoc6	UTSW	19	37608992	missense	possibly damaging	0.53
R8917:Exoc6	UTSW	19	37589912	missense	probably benign	0.35
R9003:Exoc6	UTSW	19	37598649	missense	probably damaging	1.00
R9159:Exoc6	UTSW	19	37609030	missense	probably benign	0.00
R9435:Exoc6	UTSW	19	37597097	missense	probably benign	0.00
R9459:Exoc6	UTSW	19	37585893	missense	probably benign	0.00
R9527:Exoc6	UTSW	19	37570539	missense	probably benign	0.26
R9563:Exoc6	UTSW	19	37599623	missense	probably damaging	1.00
R9730:Exoc6	UTSW	19	37599584	missense	probably benign	0.02
RF009:Exoc6	UTSW	19	37571620	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCCTGTGCTTGACAGAGTCTGTG -3'
(R):5'- AAAGCCTTTCTAATGAGATGACGGTCC -3'

Sequencing Primer
(F):5'- cgcctgactctgcctcc -3'
(R):5'- TCTAATGAGATGACGGTCCACTAAAG -3'

Posted On

2014-03-28