Incidental Mutation 'R1489:Rbm10'
ID 163630
Institutional Source Beutler Lab
Gene Symbol Rbm10
Ensembl Gene ENSMUSG00000031060
Gene Name RNA binding motif protein 10
Synonyms
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock # R1489 (G1)
Quality Score 117
Status Validated
Chromosome X
Chromosomal Location 20617503-20650901 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 20637664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064911] [ENSMUST00000082089] [ENSMUST00000084383] [ENSMUST00000115374] [ENSMUST00000115375] [ENSMUST00000177738]
AlphaFold Q99KG3
Predicted Effect probably benign
Transcript: ENSMUST00000064911
SMART Domains Protein: ENSMUSP00000068188
Gene: ENSMUSG00000031060

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
RRM 130 205 1.99e-9 SMART
ZnF_RBZ 215 239 1.2e-8 SMART
RRM 301 380 4.75e-7 SMART
low complexity region 397 419 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 593 605 N/A INTRINSIC
low complexity region 629 648 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
ZnF_C2H2 759 784 7.55e-1 SMART
coiled coil region 785 818 N/A INTRINSIC
G_patch 856 902 8.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082089
SMART Domains Protein: ENSMUSP00000080738
Gene: ENSMUSG00000031060

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RRM 60 128 9.2e-2 SMART
ZnF_RBZ 138 162 1.2e-8 SMART
RRM 224 303 4.75e-7 SMART
low complexity region 320 342 N/A INTRINSIC
low complexity region 463 485 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 552 571 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
ZnF_C2H2 682 707 7.55e-1 SMART
coiled coil region 708 741 N/A INTRINSIC
G_patch 779 825 8.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084383
SMART Domains Protein: ENSMUSP00000111031
Gene: ENSMUSG00000031060

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RRM 60 128 9.2e-2 SMART
ZnF_RBZ 138 162 1.2e-8 SMART
RRM 224 303 4.75e-7 SMART
low complexity region 320 342 N/A INTRINSIC
low complexity region 463 485 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 552 571 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
ZnF_C2H2 682 707 7.55e-1 SMART
coiled coil region 708 741 N/A INTRINSIC
G_patch 779 825 8.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115374
SMART Domains Protein: ENSMUSP00000111032
Gene: ENSMUSG00000031060

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
RRM 130 205 1.99e-9 SMART
ZnF_RBZ 215 239 1.2e-8 SMART
RRM 301 380 4.75e-7 SMART
low complexity region 397 419 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 593 605 N/A INTRINSIC
low complexity region 629 648 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
ZnF_C2H2 759 784 7.55e-1 SMART
coiled coil region 785 818 N/A INTRINSIC
G_patch 856 902 8.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115375
SMART Domains Protein: ENSMUSP00000111033
Gene: ENSMUSG00000031060

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
RRM 130 205 1.99e-9 SMART
ZnF_RBZ 215 239 1.2e-8 SMART
RRM 301 379 2.69e-6 SMART
low complexity region 396 418 N/A INTRINSIC
low complexity region 539 561 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 628 647 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
ZnF_C2H2 758 783 7.55e-1 SMART
coiled coil region 784 817 N/A INTRINSIC
G_patch 855 901 8.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141128
Predicted Effect probably benign
Transcript: ENSMUST00000177738
SMART Domains Protein: ENSMUSP00000136209
Gene: ENSMUSG00000031060

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
RRM 130 205 1.99e-9 SMART
ZnF_RBZ 215 239 1.2e-8 SMART
RRM 301 379 2.69e-6 SMART
low complexity region 396 418 N/A INTRINSIC
low complexity region 539 561 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 628 647 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
ZnF_C2H2 758 783 7.55e-1 SMART
coiled coil region 784 817 N/A INTRINSIC
G_patch 855 901 8.39e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that belongs to a family proteins that contain an RNA-binding motif. The encoded protein associates with hnRNP proteins and may be involved in regulating alternative splicing. Defects in this gene are the cause of the X-linked recessive disorder, TARP syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2011]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Numb A G 12: 83,795,443 L642P probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Rbm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Rbm10 APN X 20650692 unclassified probably benign
IGL00574:Rbm10 APN X 20650693 unclassified probably benign
R0374:Rbm10 UTSW X 20637559 small deletion probably benign
R0762:Rbm10 UTSW X 20637664 splice site probably benign
R0763:Rbm10 UTSW X 20637664 splice site probably benign
R1616:Rbm10 UTSW X 20645991 missense probably benign
R2255:Rbm10 UTSW X 20635739 missense unknown
R2937:Rbm10 UTSW X 20647695 missense possibly damaging 0.67
R2938:Rbm10 UTSW X 20647695 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTTCAGAGCCTGCCTGTCTCAGAG -3'
(R):5'- TCCCTTCCAGACCAGGAACTGATG -3'

Sequencing Primer
(F):5'- CTGTCTCAGAGAGCCAGTG -3'
(R):5'- GAACTGATGGGGCCATCC -3'
Posted On 2014-03-28