Incidental Mutation 'R1490:Atg9a'
ID163631
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Nameautophagy related 9A
SynonymsApg9l1
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75180860-75192196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75185745 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 507 (N507S)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040689
AA Change: N507S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: N507S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: N66S
Predicted Effect possibly damaging
Transcript: ENSMUST00000188347
AA Change: N507S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: N507S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189702
AA Change: N507S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: N507S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: N499S
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75190366 missense probably damaging 1.00
IGL02041:Atg9a APN 1 75183104 missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75187957 missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75187953 nonsense probably null
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0408:Atg9a UTSW 1 75185295 missense probably damaging 1.00
R0520:Atg9a UTSW 1 75186534 nonsense probably null
R0653:Atg9a UTSW 1 75190328 missense probably damaging 0.96
R0666:Atg9a UTSW 1 75185090 missense probably damaging 0.99
R0961:Atg9a UTSW 1 75186746 missense probably damaging 0.99
R1489:Atg9a UTSW 1 75186090 missense probably damaging 1.00
R1692:Atg9a UTSW 1 75190355 missense probably benign 0.04
R1997:Atg9a UTSW 1 75189626 missense probably benign 0.33
R2005:Atg9a UTSW 1 75185991 missense probably benign 0.18
R2172:Atg9a UTSW 1 75185685 missense probably damaging 0.99
R4004:Atg9a UTSW 1 75186451 missense probably damaging 1.00
R4105:Atg9a UTSW 1 75185959 missense probably damaging 1.00
R5010:Atg9a UTSW 1 75186060 unclassified probably null
R5220:Atg9a UTSW 1 75185728 missense probably damaging 1.00
R5898:Atg9a UTSW 1 75186272 missense probably damaging 1.00
R6295:Atg9a UTSW 1 75185058 missense probably benign 0.01
R6390:Atg9a UTSW 1 75187981 missense probably damaging 1.00
R7312:Atg9a UTSW 1 75188092 missense probably damaging 1.00
R7729:Atg9a UTSW 1 75184560 missense probably benign 0.34
RF021:Atg9a UTSW 1 75182629 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATATCTGTCAAAGCCCTGATGCCC -3'
(R):5'- CTTCCAGTACAAGGCAGTGAGTGG -3'

Sequencing Primer
(F):5'- gcagggatgcccacaag -3'
(R):5'- TAGGGCCTGCTAGAGACTG -3'
Posted On2014-03-28