Incidental Mutation 'R1490:Atg9a'
ID 163631
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 039542-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1490 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75162389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 507 (N507S)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189702] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect possibly damaging
Transcript: ENSMUST00000040689
AA Change: N507S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: N507S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: N66S
Predicted Effect possibly damaging
Transcript: ENSMUST00000188347
AA Change: N507S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: N507S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189702
AA Change: N507S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: N507S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: N499S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,356,234 (GRCm39) T52I probably damaging Het
Arhgef28 G A 13: 98,114,952 (GRCm39) R633W probably damaging Het
Bsn A G 9: 107,991,193 (GRCm39) S1520P probably benign Het
Cacul1 G T 19: 60,568,837 (GRCm39) A107E probably damaging Het
Cd74 A G 18: 60,944,438 (GRCm39) D216G probably damaging Het
Cdh16 A T 8: 105,348,702 (GRCm39) W109R probably damaging Het
Cdip1 C T 16: 4,586,775 (GRCm39) V100I probably damaging Het
Ceacam3 A G 7: 16,897,071 (GRCm39) D679G probably damaging Het
Comp A G 8: 70,826,563 (GRCm39) D46G possibly damaging Het
Dlx3 T C 11: 95,011,430 (GRCm39) Y95H probably benign Het
Dmrta2 T C 4: 109,837,072 (GRCm39) S5P unknown Het
E130308A19Rik A G 4: 59,719,746 (GRCm39) Y426C probably damaging Het
Entpd3 A G 9: 120,383,225 (GRCm39) S87G probably benign Het
Eps8l1 A G 7: 4,473,888 (GRCm39) R232G probably damaging Het
Gart A T 16: 91,421,232 (GRCm39) V812D probably damaging Het
Gm10153 C T 7: 141,743,879 (GRCm39) C83Y unknown Het
Gpd2 T C 2: 57,245,487 (GRCm39) V394A probably damaging Het
Hpcal1 A T 12: 17,836,225 (GRCm39) E18D probably benign Het
Mdga2 T C 12: 66,844,530 (GRCm39) D156G probably benign Het
Mks1 A G 11: 87,753,595 (GRCm39) K510E probably benign Het
Ms4a19 A G 19: 11,118,902 (GRCm39) I69T probably benign Het
Mtmr4 G A 11: 87,503,051 (GRCm39) R1035Q probably damaging Het
Myh6 T A 14: 55,200,175 (GRCm39) K235* probably null Het
Nedd1 A G 10: 92,536,660 (GRCm39) F214S probably damaging Het
Or1e32 A G 11: 73,705,197 (GRCm39) V237A possibly damaging Het
Or1o3 A G 17: 37,573,733 (GRCm39) M274T probably benign Het
Or2l13 T C 16: 19,305,672 (GRCm39) M28T probably benign Het
Or52e15 A G 7: 104,645,700 (GRCm39) I137T possibly damaging Het
Pfkfb2 A C 1: 130,625,626 (GRCm39) probably null Het
Pfkfb4 T C 9: 108,856,688 (GRCm39) L398P probably damaging Het
Pfn3 T G 13: 55,562,732 (GRCm39) D83A probably damaging Het
Pi4ka C A 16: 17,204,132 (GRCm39) W54L probably damaging Het
Ppp3r1 A G 11: 17,148,275 (GRCm39) D161G probably benign Het
Prrc2a A G 17: 35,372,230 (GRCm39) S1757P probably benign Het
Samd7 A G 3: 30,812,502 (GRCm39) E314G probably benign Het
Slc17a4 A G 13: 24,088,736 (GRCm39) I217T probably benign Het
Slc22a1 A T 17: 12,881,780 (GRCm39) probably null Het
Slc7a7 C T 14: 54,646,103 (GRCm39) R120H probably damaging Het
Sos1 A T 17: 80,721,104 (GRCm39) H905Q probably benign Het
Thada G A 17: 84,754,029 (GRCm39) T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,100,362 (GRCm39) probably benign Het
Tlr11 A C 14: 50,600,633 (GRCm39) H873P probably benign Het
Tlr4 A T 4: 66,757,611 (GRCm39) T135S possibly damaging Het
Tmem116 T C 5: 121,633,174 (GRCm39) S183P probably damaging Het
Tubgcp3 A T 8: 12,689,550 (GRCm39) I572K probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C T 1: 188,092,038 (GRCm39) T523I probably benign Het
Usp40 G A 1: 87,916,687 (GRCm39) Q364* probably null Het
Vmn1r61 T C 7: 5,614,242 (GRCm39) Q24R probably benign Het
Wdfy4 C A 14: 32,874,495 (GRCm39) probably null Het
Zfp458 G A 13: 67,405,573 (GRCm39) P286S probably damaging Het
Zfp68 A T 5: 138,605,091 (GRCm39) C373S probably benign Het
Zfp768 T A 7: 126,942,803 (GRCm39) I442F probably damaging Het
Zfp990 A G 4: 145,263,853 (GRCm39) R284G probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATCTGTCAAAGCCCTGATGCCC -3'
(R):5'- CTTCCAGTACAAGGCAGTGAGTGG -3'

Sequencing Primer
(F):5'- gcagggatgcccacaag -3'
(R):5'- TAGGGCCTGCTAGAGACTG -3'
Posted On 2014-03-28