Incidental Mutation 'R1490:Pfkfb2'
ID163633
Institutional Source Beutler Lab
Gene Symbol Pfkfb2
Ensembl Gene ENSMUSG00000026409
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms4930568D07Rik, PFK-2/FBPase-2 gene B
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130689182-130729253 bp(-) (GRCm38)
Type of Mutationintron (17 bp from exon)
DNA Base Change (assembly) A to C at 130697889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050406
AA Change: V497G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409
AA Change: V497G

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066863
AA Change: V518G

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409
AA Change: V518G

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169659
AA Change: V518G

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409
AA Change: V518G

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171479
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185233
AA Change: V518G

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409
AA Change: V518G

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably null
Transcript: ENSMUST00000187089
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188520
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189167
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189534
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191301
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000191347
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Pfkfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Pfkfb2 APN 1 130705370 splice site probably benign
IGL02273:Pfkfb2 APN 1 130707582 missense probably damaging 1.00
IGL02369:Pfkfb2 APN 1 130700835 missense probably damaging 0.99
IGL02469:Pfkfb2 APN 1 130700037 missense probably damaging 1.00
IGL02490:Pfkfb2 APN 1 130700852 missense probably damaging 1.00
R0080:Pfkfb2 UTSW 1 130714542 missense probably benign 0.20
R0616:Pfkfb2 UTSW 1 130706422 splice site probably null
R1458:Pfkfb2 UTSW 1 130708190 missense possibly damaging 0.89
R1548:Pfkfb2 UTSW 1 130698083 missense probably benign
R1554:Pfkfb2 UTSW 1 130706472 missense probably damaging 1.00
R2143:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2144:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2145:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2212:Pfkfb2 UTSW 1 130707532 missense probably damaging 1.00
R2938:Pfkfb2 UTSW 1 130705410 missense possibly damaging 0.95
R4650:Pfkfb2 UTSW 1 130705463 missense possibly damaging 0.67
R4683:Pfkfb2 UTSW 1 130706484 critical splice acceptor site probably null
R5153:Pfkfb2 UTSW 1 130701790 missense probably damaging 1.00
R5914:Pfkfb2 UTSW 1 130700095 missense probably damaging 1.00
R5976:Pfkfb2 UTSW 1 130708079 nonsense probably null
R6194:Pfkfb2 UTSW 1 130697887 makesense probably null
R6285:Pfkfb2 UTSW 1 130707562 nonsense probably null
R6956:Pfkfb2 UTSW 1 130707600 missense probably damaging 1.00
R6971:Pfkfb2 UTSW 1 130700796 missense probably damaging 1.00
R7723:Pfkfb2 UTSW 1 130707588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCAACTTGCCATCTTGCC -3'
(R):5'- GTGGTGTCCCTCCATTTCCAATCAG -3'

Sequencing Primer
(F):5'- CACACGCATGAGCTCAGATT -3'
(R):5'- AGCCAAACCCCTGTAAGGATG -3'
Posted On2014-03-28