Incidental Mutation 'R1490:E130308A19Rik'
ID163640
Institutional Source Beutler Lab
Gene Symbol E130308A19Rik
Ensembl Gene ENSMUSG00000045071
Gene NameRIKEN cDNA E130308A19 gene
Synonyms
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59626211-59761439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59719746 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 426 (Y426C)
Ref Sequence ENSEMBL: ENSMUSP00000062493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052420] [ENSMUST00000070150]
Predicted Effect probably damaging
Transcript: ENSMUST00000052420
AA Change: Y426C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062493
Gene: ENSMUSG00000045071
AA Change: Y426C

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:DUF3504 520 673 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070150
SMART Domains Protein: ENSMUSP00000065702
Gene: ENSMUSG00000045071

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
Pfam:DUF3504 532 687 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152797
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in E130308A19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:E130308A19Rik APN 4 59737743 splice site probably benign
IGL00672:E130308A19Rik APN 4 59719697 missense probably benign 0.00
IGL00937:E130308A19Rik APN 4 59690846 missense probably benign 0.01
IGL01885:E130308A19Rik APN 4 59720004 missense probably benign 0.20
IGL02638:E130308A19Rik APN 4 59719676 nonsense probably null
H8562:E130308A19Rik UTSW 4 59691033 missense possibly damaging 0.70
R0044:E130308A19Rik UTSW 4 59690290 missense possibly damaging 0.86
R0523:E130308A19Rik UTSW 4 59719716 missense probably damaging 0.98
R0788:E130308A19Rik UTSW 4 59719847 missense possibly damaging 0.76
R1215:E130308A19Rik UTSW 4 59690743 missense probably benign 0.37
R2292:E130308A19Rik UTSW 4 59690579 missense probably damaging 0.99
R3907:E130308A19Rik UTSW 4 59752393 missense probably benign 0.14
R4288:E130308A19Rik UTSW 4 59690308 missense probably benign 0.33
R4780:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4781:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4834:E130308A19Rik UTSW 4 59690317 nonsense probably null
R4985:E130308A19Rik UTSW 4 59691017 missense probably benign 0.01
R6123:E130308A19Rik UTSW 4 59737565 missense probably damaging 1.00
R6290:E130308A19Rik UTSW 4 59691332 missense probably benign 0.25
R6315:E130308A19Rik UTSW 4 59691132 missense probably benign
R6643:E130308A19Rik UTSW 4 59720561 missense possibly damaging 0.90
R6763:E130308A19Rik UTSW 4 59752288 missense probably damaging 0.99
R6980:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7036:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7078:E130308A19Rik UTSW 4 59737688 missense probably damaging 1.00
R7098:E130308A19Rik UTSW 4 59753004 missense possibly damaging 0.88
R7171:E130308A19Rik UTSW 4 59690333 missense probably damaging 1.00
R7247:E130308A19Rik UTSW 4 59690502 missense probably damaging 1.00
R7366:E130308A19Rik UTSW 4 59752770 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGTAGTGCGATAACCACAGCCC -3'
(R):5'- GGAACGCTTGAACTCCTTATCCCTG -3'

Sequencing Primer
(F):5'- ACTTTATTTCAGAGTAGCAAGTGC -3'
(R):5'- GAACTCCTTATCCCTGGTGATG -3'
Posted On2014-03-28