Incidental Mutation 'R1490:Entpd3'
ID163659
Institutional Source Beutler Lab
Gene Symbol Entpd3
Ensembl Gene ENSMUSG00000041608
Gene Nameectonucleoside triphosphate diphosphohydrolase 3
SynonymsHB6, Cd39l3, NTPDase-3
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1490 (G1)
Quality Score161
Status Not validated
Chromosome9
Chromosomal Location120539818-120568327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120554159 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 87 (S87G)
Ref Sequence ENSEMBL: ENSMUSP00000036830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047687]
Predicted Effect probably benign
Transcript: ENSMUST00000047687
AA Change: S87G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036830
Gene: ENSMUSG00000041608
AA Change: S87G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:GDA1_CD39 49 483 4.3e-102 PFAM
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143579
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma membrane-bound divalent cation-dependent E-type nucleotidase. The encoded protein is involved in the regulation of extracellular levels of ATP by hydrolysis of it and other nucleotides. Multiple transcript variants have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no deficits in nucleotide hydrolysis or alterations in nociceptive behaviors except for a modest reduction in beta-alanine-mediated itch behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Entpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Entpd3 APN 9 120561941 missense probably damaging 1.00
R0054:Entpd3 UTSW 9 120557542 missense probably damaging 0.99
R0265:Entpd3 UTSW 9 120558481 missense probably damaging 1.00
R0417:Entpd3 UTSW 9 120557421 missense probably damaging 0.99
R0607:Entpd3 UTSW 9 120557405 missense possibly damaging 0.63
R1028:Entpd3 UTSW 9 120558361 missense probably benign 0.06
R1449:Entpd3 UTSW 9 120566489 missense probably damaging 1.00
R1846:Entpd3 UTSW 9 120558375 missense probably benign 0.33
R1848:Entpd3 UTSW 9 120558419 missense probably damaging 1.00
R2125:Entpd3 UTSW 9 120555654 missense probably damaging 1.00
R3810:Entpd3 UTSW 9 120562002 missense probably benign 0.00
R5101:Entpd3 UTSW 9 120566542 makesense probably null
R5109:Entpd3 UTSW 9 120566314 missense possibly damaging 0.95
R6822:Entpd3 UTSW 9 120562038 critical splice donor site probably null
R6968:Entpd3 UTSW 9 120560656 missense probably benign 0.01
R7107:Entpd3 UTSW 9 120560599 missense probably damaging 1.00
R7132:Entpd3 UTSW 9 120561020 missense probably benign 0.00
R7310:Entpd3 UTSW 9 120560755 critical splice donor site probably null
X0017:Entpd3 UTSW 9 120555749 missense probably benign 0.41
X0024:Entpd3 UTSW 9 120561900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCACTGTGAGATGACCGCTCC -3'
(R):5'- TCCTGTGCAAACTGCGAGTTGG -3'

Sequencing Primer
(F):5'- AGATGACCGCTCCGAAGG -3'
(R):5'- TCTCATCGTGCAGAGGCATC -3'
Posted On2014-03-28