Incidental Mutation 'R1490:Mtmr4'
ID 163664
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Name myotubularin related protein 4
Synonyms ZFYVE11, FYVE-DSP2, ESTM44, FYVE zinc finger phosphatase
MMRRC Submission 039542-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R1490 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87482988-87507128 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87503051 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1035 (R1035Q)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000093956] [ENSMUST00000103179] [ENSMUST00000119628]
AlphaFold Q91XS1
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: R978Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: R978Q

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093956
SMART Domains Protein: ENSMUSP00000091488
Gene: ENSMUSG00000070345

DomainStartEndE-ValueType
HSF 11 153 2.35e-9 SMART
Blast:HSF 163 423 1e-149 BLAST
low complexity region 442 457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103179
AA Change: R1035Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: R1035Q

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119628
AA Change: R1035Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: R1035Q

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,356,234 (GRCm39) T52I probably damaging Het
Arhgef28 G A 13: 98,114,952 (GRCm39) R633W probably damaging Het
Atg9a T C 1: 75,162,389 (GRCm39) N507S possibly damaging Het
Bsn A G 9: 107,991,193 (GRCm39) S1520P probably benign Het
Cacul1 G T 19: 60,568,837 (GRCm39) A107E probably damaging Het
Cd74 A G 18: 60,944,438 (GRCm39) D216G probably damaging Het
Cdh16 A T 8: 105,348,702 (GRCm39) W109R probably damaging Het
Cdip1 C T 16: 4,586,775 (GRCm39) V100I probably damaging Het
Ceacam3 A G 7: 16,897,071 (GRCm39) D679G probably damaging Het
Comp A G 8: 70,826,563 (GRCm39) D46G possibly damaging Het
Dlx3 T C 11: 95,011,430 (GRCm39) Y95H probably benign Het
Dmrta2 T C 4: 109,837,072 (GRCm39) S5P unknown Het
E130308A19Rik A G 4: 59,719,746 (GRCm39) Y426C probably damaging Het
Entpd3 A G 9: 120,383,225 (GRCm39) S87G probably benign Het
Eps8l1 A G 7: 4,473,888 (GRCm39) R232G probably damaging Het
Gart A T 16: 91,421,232 (GRCm39) V812D probably damaging Het
Gm10153 C T 7: 141,743,879 (GRCm39) C83Y unknown Het
Gpd2 T C 2: 57,245,487 (GRCm39) V394A probably damaging Het
Hpcal1 A T 12: 17,836,225 (GRCm39) E18D probably benign Het
Mdga2 T C 12: 66,844,530 (GRCm39) D156G probably benign Het
Mks1 A G 11: 87,753,595 (GRCm39) K510E probably benign Het
Ms4a19 A G 19: 11,118,902 (GRCm39) I69T probably benign Het
Myh6 T A 14: 55,200,175 (GRCm39) K235* probably null Het
Nedd1 A G 10: 92,536,660 (GRCm39) F214S probably damaging Het
Or1e32 A G 11: 73,705,197 (GRCm39) V237A possibly damaging Het
Or1o3 A G 17: 37,573,733 (GRCm39) M274T probably benign Het
Or2l13 T C 16: 19,305,672 (GRCm39) M28T probably benign Het
Or52e15 A G 7: 104,645,700 (GRCm39) I137T possibly damaging Het
Pfkfb2 A C 1: 130,625,626 (GRCm39) probably null Het
Pfkfb4 T C 9: 108,856,688 (GRCm39) L398P probably damaging Het
Pfn3 T G 13: 55,562,732 (GRCm39) D83A probably damaging Het
Pi4ka C A 16: 17,204,132 (GRCm39) W54L probably damaging Het
Ppp3r1 A G 11: 17,148,275 (GRCm39) D161G probably benign Het
Prrc2a A G 17: 35,372,230 (GRCm39) S1757P probably benign Het
Samd7 A G 3: 30,812,502 (GRCm39) E314G probably benign Het
Slc17a4 A G 13: 24,088,736 (GRCm39) I217T probably benign Het
Slc22a1 A T 17: 12,881,780 (GRCm39) probably null Het
Slc7a7 C T 14: 54,646,103 (GRCm39) R120H probably damaging Het
Sos1 A T 17: 80,721,104 (GRCm39) H905Q probably benign Het
Thada G A 17: 84,754,029 (GRCm39) T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,100,362 (GRCm39) probably benign Het
Tlr11 A C 14: 50,600,633 (GRCm39) H873P probably benign Het
Tlr4 A T 4: 66,757,611 (GRCm39) T135S possibly damaging Het
Tmem116 T C 5: 121,633,174 (GRCm39) S183P probably damaging Het
Tubgcp3 A T 8: 12,689,550 (GRCm39) I572K probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a C T 1: 188,092,038 (GRCm39) T523I probably benign Het
Usp40 G A 1: 87,916,687 (GRCm39) Q364* probably null Het
Vmn1r61 T C 7: 5,614,242 (GRCm39) Q24R probably benign Het
Wdfy4 C A 14: 32,874,495 (GRCm39) probably null Het
Zfp458 G A 13: 67,405,573 (GRCm39) P286S probably damaging Het
Zfp68 A T 5: 138,605,091 (GRCm39) C373S probably benign Het
Zfp768 T A 7: 126,942,803 (GRCm39) I442F probably damaging Het
Zfp990 A G 4: 145,263,853 (GRCm39) R284G probably benign Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87,502,750 (GRCm39) missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87,494,893 (GRCm39) missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87,493,230 (GRCm39) unclassified probably benign
IGL01544:Mtmr4 APN 11 87,488,437 (GRCm39) splice site probably benign
IGL01574:Mtmr4 APN 11 87,491,473 (GRCm39) missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87,494,976 (GRCm39) missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87,491,950 (GRCm39) missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87,505,060 (GRCm39) missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87,491,609 (GRCm39) missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87,488,519 (GRCm39) missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87,502,829 (GRCm39) missense possibly damaging 0.63
Hippie UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
incharge UTSW 11 87,501,868 (GRCm39) nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87,501,953 (GRCm39) missense probably benign
R0009:Mtmr4 UTSW 11 87,502,334 (GRCm39) missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87,489,714 (GRCm39) missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87,501,890 (GRCm39) missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87,502,266 (GRCm39) missense probably benign 0.03
R1550:Mtmr4 UTSW 11 87,504,342 (GRCm39) missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87,493,656 (GRCm39) missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87,502,943 (GRCm39) missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87,495,916 (GRCm39) missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87,501,793 (GRCm39) missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87,491,649 (GRCm39) missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87,495,823 (GRCm39) missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87,494,923 (GRCm39) missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87,501,868 (GRCm39) nonsense probably null
R5502:Mtmr4 UTSW 11 87,504,904 (GRCm39) missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87,495,356 (GRCm39) missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87,495,875 (GRCm39) nonsense probably null
R5907:Mtmr4 UTSW 11 87,502,876 (GRCm39) missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87,494,977 (GRCm39) missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87,501,845 (GRCm39) missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87,504,353 (GRCm39) missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87,491,439 (GRCm39) missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87,495,431 (GRCm39) critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87,502,063 (GRCm39) missense probably benign
R7350:Mtmr4 UTSW 11 87,491,476 (GRCm39) missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87,495,383 (GRCm39) missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87,502,727 (GRCm39) missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87,502,702 (GRCm39) missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87,495,406 (GRCm39) missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87,488,550 (GRCm39) missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87,503,015 (GRCm39) missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87,489,690 (GRCm39) missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87,502,756 (GRCm39) nonsense probably null
R8544:Mtmr4 UTSW 11 87,502,735 (GRCm39) missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87,494,950 (GRCm39) missense probably damaging 1.00
R8971:Mtmr4 UTSW 11 87,493,626 (GRCm39) missense probably benign 0.13
R9562:Mtmr4 UTSW 11 87,493,241 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,504,916 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,503,138 (GRCm39) missense probably damaging 1.00
R9797:Mtmr4 UTSW 11 87,494,962 (GRCm39) missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87,502,651 (GRCm39) missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87,502,706 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CAGCACAAAGCCTTCTCTTCTGAGC -3'
(R):5'- AATGTCACTGGAGCACCTACAGCC -3'

Sequencing Primer
(F):5'- GCTGCCCTTCCCCAGTG -3'
(R):5'- tgctatttccttcttactgtctacc -3'
Posted On 2014-03-28