Mutagenetix > Incidental Mutation

Incidental Mutation 'R1490:Arhgef28'

163674

Institutional Source

Beutler Lab

Gene Symbol

Arhgef28

Ensembl Gene

ENSMUSG00000021662

Gene Name

Rho guanine nucleotide exchange factor (GEF) 28

Synonyms

RhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2

MMRRC Submission

039542-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1490 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97899469-98206439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 97978444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 633 (R633W)

Ref Sequence

ENSEMBL: ENSMUSP00000153423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109426
AA Change: R633W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: R633W

Domain	Start	End	E-Value	Type
low complexity region	530	568	N/A	INTRINSIC
low complexity region	634	650	N/A	INTRINSIC
C1	652	698	1.65e-11	SMART
RhoGEF	850	1040	1.11e-65	SMART
PH	1084	1187	1.08e-9	SMART
low complexity region	1267	1281	N/A	INTRINSIC
coiled coil region	1469	1522	N/A	INTRINSIC
low complexity region	1647	1663	N/A	INTRINSIC
low complexity region	1682	1693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223849
AA Change: R633W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225663

Predicted Effect

probably damaging
Transcript: ENSMUST00000225884
AA Change: R633W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	A	G	19: 11,141,538	I69T	probably benign	Het
Aldh1l2	G	A	10: 83,520,370	T52I	probably damaging	Het
Atg9a	T	C	1: 75,185,745	N507S	possibly damaging	Het
Bsn	A	G	9: 108,113,994	S1520P	probably benign	Het
Cacul1	G	T	19: 60,580,399	A107E	probably damaging	Het
Cd74	A	G	18: 60,811,366	D216G	probably damaging	Het
Cdh16	A	T	8: 104,622,070	W109R	probably damaging	Het
Cdip1	C	T	16: 4,768,911	V100I	probably damaging	Het
Ceacam3	A	G	7: 17,163,146	D679G	probably damaging	Het
Comp	A	G	8: 70,373,913	D46G	possibly damaging	Het
Dlx3	T	C	11: 95,120,604	Y95H	probably benign	Het
Dmrta2	T	C	4: 109,979,875	S5P	unknown	Het
E130308A19Rik	A	G	4: 59,719,746	Y426C	probably damaging	Het
Entpd3	A	G	9: 120,554,159	S87G	probably benign	Het
Eps8l1	A	G	7: 4,470,889	R232G	probably damaging	Het
Gart	A	T	16: 91,624,344	V812D	probably damaging	Het
Gm10153	C	T	7: 142,190,142	C83Y	unknown	Het
Gpd2	T	C	2: 57,355,475	V394A	probably damaging	Het
Hpcal1	A	T	12: 17,786,224	E18D	probably benign	Het
Mdga2	T	C	12: 66,797,756	D156G	probably benign	Het
Mks1	A	G	11: 87,862,769	K510E	probably benign	Het
Mtmr4	G	A	11: 87,612,225	R1035Q	probably damaging	Het
Myh6	T	A	14: 54,962,718	K235*	probably null	Het
Nedd1	A	G	10: 92,700,798	F214S	probably damaging	Het
Olfr166	T	C	16: 19,486,922	M28T	probably benign	Het
Olfr392	A	G	11: 73,814,371	V237A	possibly damaging	Het
Olfr672	A	G	7: 104,996,493	I137T	possibly damaging	Het
Olfr98	A	G	17: 37,262,842	M274T	probably benign	Het
Pfkfb2	A	C	1: 130,697,889		probably null	Het
Pfkfb4	T	C	9: 109,027,620	L398P	probably damaging	Het
Pfn3	T	G	13: 55,414,919	D83A	probably damaging	Het
Pi4ka	C	A	16: 17,386,268	W54L	probably damaging	Het
Ppp3r1	A	G	11: 17,198,275	D161G	probably benign	Het
Prrc2a	A	G	17: 35,153,254	S1757P	probably benign	Het
Samd7	A	G	3: 30,758,353	E314G	probably benign	Het
Slc17a4	A	G	13: 23,904,753	I217T	probably benign	Het
Slc22a1	A	T	17: 12,662,893		probably null	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Sos1	A	T	17: 80,413,675	H905Q	probably benign	Het
Thada	G	A	17: 84,446,601	T314I	possibly damaging	Het
Tirap	ACTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTG	9: 35,189,066		probably benign	Het
Tlr11	A	C	14: 50,363,176	H873P	probably benign	Het
Tlr4	A	T	4: 66,839,374	T135S	possibly damaging	Het
Tmem116	T	C	5: 121,495,111	S183P	probably damaging	Het
Tubgcp3	A	T	8: 12,639,550	I572K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	T	1: 188,359,841	T523I	probably benign	Het
Usp40	G	A	1: 87,988,965	Q364*	probably null	Het
Vmn1r61	T	C	7: 5,611,243	Q24R	probably benign	Het
Wdfy4	C	A	14: 33,152,538		probably null	Het
Zfp458	G	A	13: 67,257,509	P286S	probably damaging	Het
Zfp68	A	T	5: 138,606,829	C373S	probably benign	Het
Zfp768	T	A	7: 127,343,631	I442F	probably damaging	Het
Zfp990	A	G	4: 145,537,283	R284G	probably benign	Het

Other mutations in Arhgef28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Arhgef28	APN	13	97988277	missense	probably benign	0.15
IGL00945:Arhgef28	APN	13	97967399	missense	possibly damaging	0.88
IGL01099:Arhgef28	APN	13	97953972	splice site	probably benign
IGL01328:Arhgef28	APN	13	97970323	missense	probably damaging	1.00
IGL01396:Arhgef28	APN	13	97953893	missense	probably damaging	0.99
IGL02067:Arhgef28	APN	13	98077317	missense	probably damaging	1.00
IGL02147:Arhgef28	APN	13	97961314	missense	probably damaging	1.00
IGL02285:Arhgef28	APN	13	98051028	missense	possibly damaging	0.85
IGL02439:Arhgef28	APN	13	97931139	missense	possibly damaging	0.75
IGL02499:Arhgef28	APN	13	97953783	missense	possibly damaging	0.87
IGL02532:Arhgef28	APN	13	98029883	missense	probably damaging	0.99
IGL02634:Arhgef28	APN	13	98051058	missense	probably benign	0.00
IGL02902:Arhgef28	APN	13	97946875	missense	probably damaging	1.00
IGL03067:Arhgef28	APN	13	97988286	missense	probably benign	0.00
IGL03081:Arhgef28	APN	13	98029373	splice site	probably benign
IGL03106:Arhgef28	APN	13	97957793	missense	probably damaging	1.00
IGL03195:Arhgef28	APN	13	97951563	splice site	probably null
IGL03325:Arhgef28	APN	13	97899816	missense	probably benign	0.03
H8786:Arhgef28	UTSW	13	97946953	missense	probably damaging	1.00
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0090:Arhgef28	UTSW	13	98075110	missense	probably damaging	0.99
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0537:Arhgef28	UTSW	13	97957716	missense	probably damaging	1.00
R0617:Arhgef28	UTSW	13	97970355	missense	probably benign	0.21
R0711:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0723:Arhgef28	UTSW	13	97939479	missense	probably benign	0.16
R0790:Arhgef28	UTSW	13	97981406	missense	possibly damaging	0.51
R1240:Arhgef28	UTSW	13	97929492	missense	probably benign	0.00
R1365:Arhgef28	UTSW	13	98075124	missense	probably damaging	1.00
R1456:Arhgef28	UTSW	13	98075002	missense	probably benign	0.01
R1496:Arhgef28	UTSW	13	97965546	missense	possibly damaging	0.93
R1660:Arhgef28	UTSW	13	97981376	missense	probably benign	0.05
R1671:Arhgef28	UTSW	13	97931034	missense	possibly damaging	0.95
R1747:Arhgef28	UTSW	13	97936824	missense	probably damaging	1.00
R1792:Arhgef28	UTSW	13	97931186	missense	probably benign	0.03
R1864:Arhgef28	UTSW	13	97994132	missense	probably benign	0.00
R1887:Arhgef28	UTSW	13	98145573	missense	probably damaging	0.97
R1924:Arhgef28	UTSW	13	97936816	splice site	probably benign
R1987:Arhgef28	UTSW	13	97967096	missense	probably benign
R2215:Arhgef28	UTSW	13	98051021	missense	possibly damaging	0.78
R2342:Arhgef28	UTSW	13	97994029	missense	probably benign	0.00
R2495:Arhgef28	UTSW	13	98029373	splice site	probably benign
R3897:Arhgef28	UTSW	13	97956576	missense	probably damaging	1.00
R3922:Arhgef28	UTSW	13	97993944	missense	possibly damaging	0.92
R4063:Arhgef28	UTSW	13	97994067	missense	probably benign	0.16
R4086:Arhgef28	UTSW	13	97967204	missense	probably damaging	0.98
R4543:Arhgef28	UTSW	13	98075000	missense	probably benign	0.00
R4730:Arhgef28	UTSW	13	97978142	missense	probably benign	0.00
R4735:Arhgef28	UTSW	13	97899729	missense	probably damaging	1.00
R4953:Arhgef28	UTSW	13	97929554	missense	possibly damaging	0.51
R5069:Arhgef28	UTSW	13	98075206	missense	probably damaging	0.96
R5558:Arhgef28	UTSW	13	97961460	missense	probably damaging	1.00
R5573:Arhgef28	UTSW	13	97929491	missense	probably benign	0.01
R5594:Arhgef28	UTSW	13	97939492	missense	probably benign	0.00
R5937:Arhgef28	UTSW	13	97939543	missense	probably benign	0.00
R5987:Arhgef28	UTSW	13	97936860	nonsense	probably null
R6015:Arhgef28	UTSW	13	98075022	missense	possibly damaging	0.73
R6193:Arhgef28	UTSW	13	97985380	missense	probably damaging	1.00
R6209:Arhgef28	UTSW	13	97929409	critical splice donor site	probably null
R6306:Arhgef28	UTSW	13	97985388	missense	probably damaging	1.00
R6393:Arhgef28	UTSW	13	97994019	missense	possibly damaging	0.64
R6562:Arhgef28	UTSW	13	97988139	critical splice donor site	probably null
R6646:Arhgef28	UTSW	13	97939494	missense	probably benign	0.09
R6655:Arhgef28	UTSW	13	97899655	missense	probably damaging	1.00
R6707:Arhgef28	UTSW	13	97936716	missense	probably damaging	0.96
R6707:Arhgef28	UTSW	13	98075116	missense	possibly damaging	0.80
R6751:Arhgef28	UTSW	13	98075247	missense	probably damaging	0.97
R6940:Arhgef28	UTSW	13	97965530	missense	possibly damaging	0.58
R7018:Arhgef28	UTSW	13	97965435	missense	probably damaging	1.00
R7030:Arhgef28	UTSW	13	97988261	missense	possibly damaging	0.88
R7120:Arhgef28	UTSW	13	97944539	missense	probably damaging	1.00
R7266:Arhgef28	UTSW	13	97965452	missense	probably benign
R7353:Arhgef28	UTSW	13	98075202	missense	probably damaging	1.00
R7368:Arhgef28	UTSW	13	97996862	missense	probably benign	0.34
R7491:Arhgef28	UTSW	13	97944686	missense	probably benign	0.03
R7500:Arhgef28	UTSW	13	97978495	missense	probably benign	0.00
R7653:Arhgef28	UTSW	13	97969313	missense	probably benign	0.04
R7813:Arhgef28	UTSW	13	97945681	missense	possibly damaging	0.48
R7989:Arhgef28	UTSW	13	97899735	missense	probably benign
R8064:Arhgef28	UTSW	13	97978494	missense	probably benign	0.13
R8221:Arhgef28	UTSW	13	98145556	missense	probably benign	0.00
R8293:Arhgef28	UTSW	13	97942521	missense	probably benign	0.00
R8328:Arhgef28	UTSW	13	98051009	missense	possibly damaging	0.88
R8348:Arhgef28	UTSW	13	98053867	missense	possibly damaging	0.50
R8432:Arhgef28	UTSW	13	97951583	missense	probably benign	0.29
R8843:Arhgef28	UTSW	13	97994049	missense	probably benign
R8859:Arhgef28	UTSW	13	97945702	missense	probably damaging	1.00
R8954:Arhgef28	UTSW	13	97929633	missense	probably benign	0.03
R8987:Arhgef28	UTSW	13	98053964	missense	possibly damaging	0.87
R9253:Arhgef28	UTSW	13	97988271	missense	probably benign	0.09
R9351:Arhgef28	UTSW	13	97994068	missense	probably benign	0.11
R9381:Arhgef28	UTSW	13	97899761	missense	possibly damaging	0.60
R9395:Arhgef28	UTSW	13	97967184	frame shift	probably null
R9466:Arhgef28	UTSW	13	97988317	missense
R9529:Arhgef28	UTSW	13	98077265	missense	probably damaging	1.00
Z1088:Arhgef28	UTSW	13	97945691	missense	probably damaging	1.00
Z1177:Arhgef28	UTSW	13	97899756	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- TGACCCATGCACGGGCTTTAAC -3'
(R):5'- AGCGACCAGAAACGCCTATCTATTG -3'

Sequencing Primer
(F):5'- GGCTTTAACAATCCTAACGAGCTG -3'
(R):5'- GTAGAGACATAACGCTCTTCTCG -3'

Posted On

2014-03-28