Mutagenetix > Incidental Mutations

Incidental Mutation 'R1490:Wdfy4'

163675

Institutional Source

Beutler Lab

Gene Symbol

Wdfy4

Ensembl Gene

ENSMUSG00000051506

Gene Name

WD repeat and FYVE domain containing 4

Synonyms

MMRRC Submission

039542-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1490 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32959547-33185508 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 33152538 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]

Predicted Effect

probably null
Transcript: ENSMUST00000061753

SMART Domains

Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
low complexity region	1899	1909	N/A	INTRINSIC
Pfam:PH_BEACH	2237	2348	1.2e-9	PFAM
Beach	2378	2660	3.69e-196	SMART
WD40	2761	2801	1.98e1	SMART
WD40	2811	2850	5.18e-7	SMART
WD40	2853	2891	9.94e-1	SMART
WD40	2893	2940	3.17e-2	SMART
WD40	2986	3021	3.31e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000130509

SMART Domains

Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1596	1615	N/A	INTRINSIC
low complexity region	1795	1819	N/A	INTRINSIC
low complexity region	2019	2029	N/A	INTRINSIC
Pfam:PH_BEACH	2362	2473	1.2e-9	PFAM
Beach	2503	2785	3.69e-196	SMART
WD40	2886	2926	1.98e1	SMART
WD40	2936	2975	5.18e-7	SMART
WD40	2978	3016	9.94e-1	SMART
WD40	3018	3065	3.17e-2	SMART
WD40	3111	3146	3.31e0	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	A	G	19: 11,141,538	I69T	probably benign	Het
Aldh1l2	G	A	10: 83,520,370	T52I	probably damaging	Het
Arhgef28	G	A	13: 97,978,444	R633W	probably damaging	Het
Atg9a	T	C	1: 75,185,745	N507S	possibly damaging	Het
Bsn	A	G	9: 108,113,994	S1520P	probably benign	Het
Cacul1	G	T	19: 60,580,399	A107E	probably damaging	Het
Cd74	A	G	18: 60,811,366	D216G	probably damaging	Het
Cdh16	A	T	8: 104,622,070	W109R	probably damaging	Het
Cdip1	C	T	16: 4,768,911	V100I	probably damaging	Het
Ceacam3	A	G	7: 17,163,146	D679G	probably damaging	Het
Comp	A	G	8: 70,373,913	D46G	possibly damaging	Het
Dlx3	T	C	11: 95,120,604	Y95H	probably benign	Het
Dmrta2	T	C	4: 109,979,875	S5P	unknown	Het
E130308A19Rik	A	G	4: 59,719,746	Y426C	probably damaging	Het
Entpd3	A	G	9: 120,554,159	S87G	probably benign	Het
Eps8l1	A	G	7: 4,470,889	R232G	probably damaging	Het
Gart	A	T	16: 91,624,344	V812D	probably damaging	Het
Gm10153	C	T	7: 142,190,142	C83Y	unknown	Het
Gpd2	T	C	2: 57,355,475	V394A	probably damaging	Het
Hpcal1	A	T	12: 17,786,224	E18D	probably benign	Het
Mdga2	T	C	12: 66,797,756	D156G	probably benign	Het
Mks1	A	G	11: 87,862,769	K510E	probably benign	Het
Mtmr4	G	A	11: 87,612,225	R1035Q	probably damaging	Het
Myh6	T	A	14: 54,962,718	K235*	probably null	Het
Nedd1	A	G	10: 92,700,798	F214S	probably damaging	Het
Olfr166	T	C	16: 19,486,922	M28T	probably benign	Het
Olfr392	A	G	11: 73,814,371	V237A	possibly damaging	Het
Olfr672	A	G	7: 104,996,493	I137T	possibly damaging	Het
Olfr98	A	G	17: 37,262,842	M274T	probably benign	Het
Pfkfb2	A	C	1: 130,697,889		probably null	Het
Pfkfb4	T	C	9: 109,027,620	L398P	probably damaging	Het
Pfn3	T	G	13: 55,414,919	D83A	probably damaging	Het
Pi4ka	C	A	16: 17,386,268	W54L	probably damaging	Het
Ppp3r1	A	G	11: 17,198,275	D161G	probably benign	Het
Prrc2a	A	G	17: 35,153,254	S1757P	probably benign	Het
Samd7	A	G	3: 30,758,353	E314G	probably benign	Het
Slc17a4	A	G	13: 23,904,753	I217T	probably benign	Het
Slc22a1	A	T	17: 12,662,893		probably null	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Sos1	A	T	17: 80,413,675	H905Q	probably benign	Het
Thada	G	A	17: 84,446,601	T314I	possibly damaging	Het
Tirap	ACTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTG	9: 35,189,066		probably benign	Het
Tlr11	A	C	14: 50,363,176	H873P	probably benign	Het
Tlr4	A	T	4: 66,839,374	T135S	possibly damaging	Het
Tmem116	T	C	5: 121,495,111	S183P	probably damaging	Het
Tubgcp3	A	T	8: 12,639,550	I572K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	T	1: 188,359,841	T523I	probably benign	Het
Usp40	G	A	1: 87,988,965	Q364*	probably null	Het
Vmn1r61	T	C	7: 5,611,243	Q24R	probably benign	Het
Zfp458	G	A	13: 67,257,509	P286S	probably damaging	Het
Zfp68	A	T	5: 138,606,829	C373S	probably benign	Het
Zfp768	T	A	7: 127,343,631	I442F	probably damaging	Het
Zfp990	A	G	4: 145,537,283	R284G	probably benign	Het

Other mutations in Wdfy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wdfy4	APN	14	33102539	missense	possibly damaging	0.93
IGL01116:Wdfy4	APN	14	32959977	missense	probably damaging	1.00
IGL01449:Wdfy4	APN	14	33104037	missense	probably damaging	0.99
IGL01567:Wdfy4	APN	14	33151661	missense	probably benign	0.01
IGL01700:Wdfy4	APN	14	33020238	splice site	probably benign
IGL01931:Wdfy4	APN	14	33155753	missense	probably damaging	1.00
IGL01981:Wdfy4	APN	14	33133716	missense	probably damaging	1.00
IGL01988:Wdfy4	APN	14	33076480	missense	possibly damaging	0.75
IGL02026:Wdfy4	APN	14	33093300	missense	probably damaging	1.00
IGL02066:Wdfy4	APN	14	33149566	missense	probably benign
IGL02468:Wdfy4	APN	14	32966432	missense	probably benign	0.01
IGL02512:Wdfy4	APN	14	33042491	missense	probably benign	0.01
IGL02597:Wdfy4	APN	14	33090861	nonsense	probably null
IGL02752:Wdfy4	APN	14	33076326	missense	probably damaging	1.00
IGL02792:Wdfy4	APN	14	33095305	missense	probably benign	0.01
IGL02826:Wdfy4	APN	14	32971750	missense	possibly damaging	0.47
IGL02903:Wdfy4	APN	14	33109650	missense	probably damaging	1.00
IGL02955:Wdfy4	APN	14	33076284	missense	probably damaging	1.00
IGL03031:Wdfy4	APN	14	33140651	missense	probably damaging	1.00
IGL03102:Wdfy4	APN	14	32966435	missense	probably damaging	1.00
IGL03123:Wdfy4	APN	14	33162870	missense	probably benign	0.01
IGL03198:Wdfy4	APN	14	33125887	missense	probably damaging	1.00
IGL03250:Wdfy4	APN	14	32977167	missense	probably damaging	0.99
IGL03277:Wdfy4	APN	14	33068904	missense	probably benign	0.01
IGL03398:Wdfy4	APN	14	33047290	missense	probably benign	0.14
Dollar	UTSW	14	33020311	missense	probably damaging	1.00
kings_canyon	UTSW	14	33109519	nonsense	probably null
moro	UTSW	14	32964626	splice site	probably null
sequoia	UTSW	14	33100903	critical splice donor site	probably null
Sherman	UTSW	14	33095951	missense	possibly damaging	0.89
watchtower	UTSW	14	33083639	critical splice donor site	probably null
R0014:Wdfy4	UTSW	14	33107173	missense	possibly damaging	0.72
R0067:Wdfy4	UTSW	14	33162751	missense	probably null	1.00
R0085:Wdfy4	UTSW	14	33078243	missense	possibly damaging	0.81
R0277:Wdfy4	UTSW	14	33083785	missense	possibly damaging	0.83
R0436:Wdfy4	UTSW	14	33083812	splice site	probably benign
R0496:Wdfy4	UTSW	14	33140738	splice site	probably benign
R0514:Wdfy4	UTSW	14	33080775	missense	probably benign	0.22
R0548:Wdfy4	UTSW	14	33042621	missense	probably benign
R0590:Wdfy4	UTSW	14	33041174	missense	probably benign	0.09
R0647:Wdfy4	UTSW	14	33109699	missense	possibly damaging	0.96
R0766:Wdfy4	UTSW	14	33140612	missense	probably damaging	1.00
R0981:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R1024:Wdfy4	UTSW	14	33079966	missense	possibly damaging	0.81
R1113:Wdfy4	UTSW	14	32971738	missense	possibly damaging	0.47
R1252:Wdfy4	UTSW	14	32971772	splice site	probably null
R1415:Wdfy4	UTSW	14	33041180	missense	possibly damaging	0.60
R1475:Wdfy4	UTSW	14	33108688	missense	probably benign	0.14
R1483:Wdfy4	UTSW	14	33100966	missense	probably benign	0.41
R1512:Wdfy4	UTSW	14	32960808	missense	probably damaging	0.98
R1615:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R1628:Wdfy4	UTSW	14	32959961	missense	probably damaging	1.00
R1643:Wdfy4	UTSW	14	33073585	critical splice acceptor site	probably null
R1729:Wdfy4	UTSW	14	33096005	missense	possibly damaging	0.85
R1859:Wdfy4	UTSW	14	33103983	missense	probably damaging	0.99
R1933:Wdfy4	UTSW	14	33133344	missense	probably benign	0.08
R1957:Wdfy4	UTSW	14	32971684	missense	probably damaging	1.00
R1968:Wdfy4	UTSW	14	33106044	missense	possibly damaging	0.95
R2032:Wdfy4	UTSW	14	33146989	missense	probably benign	0.11
R2241:Wdfy4	UTSW	14	33073511	missense	possibly damaging	0.81
R2391:Wdfy4	UTSW	14	33162807	missense	possibly damaging	0.92
R2888:Wdfy4	UTSW	14	33109519	nonsense	probably null
R2889:Wdfy4	UTSW	14	33109519	nonsense	probably null
R3114:Wdfy4	UTSW	14	33089903	missense	probably damaging	0.97
R3757:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3758:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3797:Wdfy4	UTSW	14	33140645	missense	probably damaging	1.00
R3890:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3892:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3945:Wdfy4	UTSW	14	32966395	missense	probably damaging	0.99
R4011:Wdfy4	UTSW	14	33102680	splice site	probably benign
R4091:Wdfy4	UTSW	14	33125880	missense	possibly damaging	0.93
R4449:Wdfy4	UTSW	14	33096083	missense	probably damaging	1.00
R4585:Wdfy4	UTSW	14	33087955	missense	possibly damaging	0.89
R4628:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4629:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4655:Wdfy4	UTSW	14	32989936	missense	probably damaging	0.98
R4689:Wdfy4	UTSW	14	33109548	missense	possibly damaging	0.88
R4718:Wdfy4	UTSW	14	33145316	missense	probably benign	0.03
R4862:Wdfy4	UTSW	14	33100903	critical splice donor site	probably null
R4884:Wdfy4	UTSW	14	32988895	nonsense	probably null
R4894:Wdfy4	UTSW	14	33155760	missense	probably benign	0.03
R4929:Wdfy4	UTSW	14	33047256	missense	possibly damaging	0.90
R4932:Wdfy4	UTSW	14	33029013	missense	probably damaging	1.00
R5014:Wdfy4	UTSW	14	33100940	missense	probably benign	0.02
R5020:Wdfy4	UTSW	14	33079935	missense	probably damaging	1.00
R5049:Wdfy4	UTSW	14	33152670	missense	possibly damaging	0.78
R5276:Wdfy4	UTSW	14	33047275	missense	probably damaging	1.00
R5318:Wdfy4	UTSW	14	33078343	missense	possibly damaging	0.95
R5338:Wdfy4	UTSW	14	33090866	missense	probably damaging	1.00
R5349:Wdfy4	UTSW	14	32988899	missense	probably damaging	1.00
R5411:Wdfy4	UTSW	14	32960002	missense	probably damaging	1.00
R5435:Wdfy4	UTSW	14	33020311	missense	probably damaging	1.00
R5463:Wdfy4	UTSW	14	33151732	missense	probably benign	0.17
R5591:Wdfy4	UTSW	14	33107130	missense	probably benign	0.09
R5598:Wdfy4	UTSW	14	33133497	missense	probably damaging	1.00
R5654:Wdfy4	UTSW	14	33107618	splice site	probably null
R5890:Wdfy4	UTSW	14	33102577	missense	possibly damaging	0.91
R5894:Wdfy4	UTSW	14	33133360	missense	possibly damaging	0.86
R5964:Wdfy4	UTSW	14	33106011	missense	probably damaging	1.00
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6074:Wdfy4	UTSW	14	33083639	critical splice donor site	probably null
R6135:Wdfy4	UTSW	14	32971711	missense	probably damaging	0.99
R6276:Wdfy4	UTSW	14	33109525	missense	possibly damaging	0.54
R6357:Wdfy4	UTSW	14	33101049	nonsense	probably null
R6370:Wdfy4	UTSW	14	33068850	missense	probably benign	0.16
R6390:Wdfy4	UTSW	14	33104094	missense	probably damaging	0.99
R6413:Wdfy4	UTSW	14	32967647	missense	probably damaging	1.00
R6450:Wdfy4	UTSW	14	33108692	missense	probably damaging	1.00
R6522:Wdfy4	UTSW	14	33146944	missense	probably damaging	0.98
R6657:Wdfy4	UTSW	14	33047251	missense	possibly damaging	0.70
R6761:Wdfy4	UTSW	14	33095951	missense	possibly damaging	0.89
R6763:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R6952:Wdfy4	UTSW	14	32959966	missense	probably damaging	1.00
R6985:Wdfy4	UTSW	14	33099117	missense	possibly damaging	0.68
R7024:Wdfy4	UTSW	14	32964626	splice site	probably null
R7101:Wdfy4	UTSW	14	32960820	missense
R7114:Wdfy4	UTSW	14	32971574	splice site	probably null
R7139:Wdfy4	UTSW	14	33151578	missense
R7255:Wdfy4	UTSW	14	32974282	missense
R7324:Wdfy4	UTSW	14	33047314	missense
R7379:Wdfy4	UTSW	14	33151609	missense
R7399:Wdfy4	UTSW	14	33068906	missense
R7408:Wdfy4	UTSW	14	33078307	missense
R7410:Wdfy4	UTSW	14	32974234	missense
R7411:Wdfy4	UTSW	14	33106131	missense
R7412:Wdfy4	UTSW	14	33149584	missense
R7445:Wdfy4	UTSW	14	33070618	nonsense	probably null
R7595:Wdfy4	UTSW	14	32974154	critical splice donor site	probably null
R7618:Wdfy4	UTSW	14	32985739	missense
R7622:Wdfy4	UTSW	14	33078274	missense
R7828:Wdfy4	UTSW	14	32988921	missense	possibly damaging	0.90
X0028:Wdfy4	UTSW	14	33080636	missense	probably benign
X0053:Wdfy4	UTSW	14	33162942	start codon destroyed	probably null	0.99
X0062:Wdfy4	UTSW	14	33107618	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTAGTGATGGTGCTCACGCAG -3'
(R):5'- AGCTTGATGCATGTCAGAGTTCCC -3'

Sequencing Primer
(F):5'- CTCCAATTTTCCAAGTGGGACAG -3'
(R):5'- ATGTCAGAGTTCCCGCTGC -3'

Posted On

2014-03-28