Mutagenetix > Incidental Mutations

Incidental Mutation 'R1490:Pi4ka'

163680

Institutional Source

Beutler Lab

Gene Symbol

Pi4ka

Ensembl Gene

ENSMUSG00000041720

Gene Name

phosphatidylinositol 4-kinase alpha

Synonyms

Pik4ca

MMRRC Submission

039542-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1490 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17280351-17406314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 17386268 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 54 (W54L)

Ref Sequence

ENSEMBL: ENSMUSP00000036162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036161
AA Change: W54L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: W54L

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128938

Predicted Effect

probably damaging
Transcript: ENSMUST00000154364
AA Change: W54L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: W54L

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231419

Predicted Effect

probably damaging
Transcript: ENSMUST00000232232
AA Change: W54L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	A	G	19: 11,141,538	I69T	probably benign	Het
Aldh1l2	G	A	10: 83,520,370	T52I	probably damaging	Het
Arhgef28	G	A	13: 97,978,444	R633W	probably damaging	Het
Atg9a	T	C	1: 75,185,745	N507S	possibly damaging	Het
Bsn	A	G	9: 108,113,994	S1520P	probably benign	Het
Cacul1	G	T	19: 60,580,399	A107E	probably damaging	Het
Cd74	A	G	18: 60,811,366	D216G	probably damaging	Het
Cdh16	A	T	8: 104,622,070	W109R	probably damaging	Het
Cdip1	C	T	16: 4,768,911	V100I	probably damaging	Het
Ceacam3	A	G	7: 17,163,146	D679G	probably damaging	Het
Comp	A	G	8: 70,373,913	D46G	possibly damaging	Het
Dlx3	T	C	11: 95,120,604	Y95H	probably benign	Het
Dmrta2	T	C	4: 109,979,875	S5P	unknown	Het
E130308A19Rik	A	G	4: 59,719,746	Y426C	probably damaging	Het
Entpd3	A	G	9: 120,554,159	S87G	probably benign	Het
Eps8l1	A	G	7: 4,470,889	R232G	probably damaging	Het
Gart	A	T	16: 91,624,344	V812D	probably damaging	Het
Gm10153	C	T	7: 142,190,142	C83Y	unknown	Het
Gpd2	T	C	2: 57,355,475	V394A	probably damaging	Het
Hpcal1	A	T	12: 17,786,224	E18D	probably benign	Het
Mdga2	T	C	12: 66,797,756	D156G	probably benign	Het
Mks1	A	G	11: 87,862,769	K510E	probably benign	Het
Mtmr4	G	A	11: 87,612,225	R1035Q	probably damaging	Het
Myh6	T	A	14: 54,962,718	K235*	probably null	Het
Nedd1	A	G	10: 92,700,798	F214S	probably damaging	Het
Olfr166	T	C	16: 19,486,922	M28T	probably benign	Het
Olfr392	A	G	11: 73,814,371	V237A	possibly damaging	Het
Olfr672	A	G	7: 104,996,493	I137T	possibly damaging	Het
Olfr98	A	G	17: 37,262,842	M274T	probably benign	Het
Pfkfb2	A	C	1: 130,697,889		probably null	Het
Pfkfb4	T	C	9: 109,027,620	L398P	probably damaging	Het
Pfn3	T	G	13: 55,414,919	D83A	probably damaging	Het
Ppp3r1	A	G	11: 17,198,275	D161G	probably benign	Het
Prrc2a	A	G	17: 35,153,254	S1757P	probably benign	Het
Samd7	A	G	3: 30,758,353	E314G	probably benign	Het
Slc17a4	A	G	13: 23,904,753	I217T	probably benign	Het
Slc22a1	A	T	17: 12,662,893		probably null	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Sos1	A	T	17: 80,413,675	H905Q	probably benign	Het
Thada	G	A	17: 84,446,601	T314I	possibly damaging	Het
Tirap	ACTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTG	9: 35,189,066		probably benign	Het
Tlr11	A	C	14: 50,363,176	H873P	probably benign	Het
Tlr4	A	T	4: 66,839,374	T135S	possibly damaging	Het
Tmem116	T	C	5: 121,495,111	S183P	probably damaging	Het
Tubgcp3	A	T	8: 12,639,550	I572K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	T	1: 188,359,841	T523I	probably benign	Het
Usp40	G	A	1: 87,988,965	Q364*	probably null	Het
Vmn1r61	T	C	7: 5,611,243	Q24R	probably benign	Het
Wdfy4	C	A	14: 33,152,538		probably null	Het
Zfp458	G	A	13: 67,257,509	P286S	probably damaging	Het
Zfp68	A	T	5: 138,606,829	C373S	probably benign	Het
Zfp768	T	A	7: 127,343,631	I442F	probably damaging	Het
Zfp990	A	G	4: 145,537,283	R284G	probably benign	Het

Other mutations in Pi4ka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Pi4ka	APN	16	17308144	missense	probably benign
IGL00984:Pi4ka	APN	16	17358932	nonsense	probably null
IGL01066:Pi4ka	APN	16	17348773	splice site	probably benign
IGL01460:Pi4ka	APN	16	17357651	missense	probably damaging	1.00
IGL01505:Pi4ka	APN	16	17309358	missense	probably benign	0.22
IGL01518:Pi4ka	APN	16	17280735	missense	probably benign	0.03
IGL01533:Pi4ka	APN	16	17308201	missense	probably benign	0.30
IGL01565:Pi4ka	APN	16	17389442	utr 5 prime	probably benign
IGL01679:Pi4ka	APN	16	17296888	splice site	probably benign
IGL01685:Pi4ka	APN	16	17325202	missense	probably benign	0.09
IGL01734:Pi4ka	APN	16	17297260	missense	probably benign	0.23
IGL01799:Pi4ka	APN	16	17389371	missense	probably damaging	1.00
IGL01969:Pi4ka	APN	16	17378483	missense	probably benign	0.15
IGL02092:Pi4ka	APN	16	17318496	missense	probably benign	0.00
IGL02113:Pi4ka	APN	16	17373415	missense	probably benign	0.00
IGL02177:Pi4ka	APN	16	17318282	missense	probably benign	0.09
IGL02400:Pi4ka	APN	16	17293884	missense	probably damaging	0.98
IGL02426:Pi4ka	APN	16	17378432	splice site	probably benign
IGL02474:Pi4ka	APN	16	17325429	missense	probably damaging	1.00
IGL02587:Pi4ka	APN	16	17317353	missense	probably damaging	1.00
IGL02667:Pi4ka	APN	16	17295461	missense	possibly damaging	0.82
IGL02698:Pi4ka	APN	16	17291168	missense	probably damaging	1.00
IGL02815:Pi4ka	APN	16	17358889	splice site	probably benign
IGL02828:Pi4ka	APN	16	17280711	intron	probably benign
IGL02939:Pi4ka	APN	16	17354210	missense	probably damaging	0.97
IGL03123:Pi4ka	APN	16	17282675	missense	possibly damaging	0.95
IGL03148:Pi4ka	APN	16	17354189	missense	probably damaging	0.99
arachnoid	UTSW	16	17285281	unclassified	probably benign
dove_bar	UTSW	16	17326052	splice site	probably null
mia	UTSW	16	17376982	missense	possibly damaging	0.89
pia	UTSW	16	17281044	missense	probably damaging	1.00
IGL03098:Pi4ka	UTSW	16	17326027	missense	probably damaging	1.00
R0024:Pi4ka	UTSW	16	17315535	splice site	probably benign
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0243:Pi4ka	UTSW	16	17297635	missense	probably benign	0.44
R0374:Pi4ka	UTSW	16	17282932	unclassified	probably benign
R0478:Pi4ka	UTSW	16	17309311	missense	possibly damaging	0.92
R0548:Pi4ka	UTSW	16	17307718	missense	possibly damaging	0.75
R0626:Pi4ka	UTSW	16	17293901	missense	probably benign	0.00
R0918:Pi4ka	UTSW	16	17285260	missense	possibly damaging	0.61
R1082:Pi4ka	UTSW	16	17389352	missense	probably damaging	1.00
R1384:Pi4ka	UTSW	16	17297537	splice site	probably benign
R1455:Pi4ka	UTSW	16	17363954	missense	probably benign	0.02
R1479:Pi4ka	UTSW	16	17373400	missense	probably benign	0.08
R1565:Pi4ka	UTSW	16	17281900	missense	probably null
R1594:Pi4ka	UTSW	16	17373419	splice site	probably benign
R1641:Pi4ka	UTSW	16	17377030	missense	probably benign	0.00
R1694:Pi4ka	UTSW	16	17295376	missense	probably damaging	0.99
R1828:Pi4ka	UTSW	16	17280750	missense	probably benign	0.00
R1864:Pi4ka	UTSW	16	17367525	nonsense	probably null
R2036:Pi4ka	UTSW	16	17303112	missense	probably damaging	1.00
R2151:Pi4ka	UTSW	16	17367507	missense	probably benign	0.44
R2844:Pi4ka	UTSW	16	17350793	missense	probably damaging	0.97
R2876:Pi4ka	UTSW	16	17367550	missense	possibly damaging	0.77
R3953:Pi4ka	UTSW	16	17285281	unclassified	probably benign
R3972:Pi4ka	UTSW	16	17293875	missense	probably damaging	1.00
R4357:Pi4ka	UTSW	16	17367439	missense	probably benign	0.00
R4385:Pi4ka	UTSW	16	17386265	missense	probably benign	0.13
R4427:Pi4ka	UTSW	16	17281044	missense	probably damaging	1.00
R4436:Pi4ka	UTSW	16	17282382	missense	probably damaging	1.00
R4677:Pi4ka	UTSW	16	17282373	missense	probably damaging	1.00
R4683:Pi4ka	UTSW	16	17297037	missense	possibly damaging	0.73
R4736:Pi4ka	UTSW	16	17377175	missense	probably benign	0.12
R4804:Pi4ka	UTSW	16	17308161	missense	possibly damaging	0.75
R4886:Pi4ka	UTSW	16	17358361	missense	probably damaging	0.98
R4893:Pi4ka	UTSW	16	17377036	missense	probably benign	0.21
R4896:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5004:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5015:Pi4ka	UTSW	16	17303082	missense	possibly damaging	0.56
R5062:Pi4ka	UTSW	16	17309397	missense	probably benign	0.02
R5104:Pi4ka	UTSW	16	17281050	missense	probably damaging	1.00
R5160:Pi4ka	UTSW	16	17323053	missense	probably benign	0.01
R5173:Pi4ka	UTSW	16	17350906	missense	possibly damaging	0.95
R5204:Pi4ka	UTSW	16	17359045	missense	possibly damaging	0.68
R5307:Pi4ka	UTSW	16	17323030	missense	probably benign	0.00
R5327:Pi4ka	UTSW	16	17325413	missense	probably damaging	1.00
R5506:Pi4ka	UTSW	16	17293953	missense	probably damaging	0.96
R5580:Pi4ka	UTSW	16	17281087	missense	probably damaging	1.00
R5768:Pi4ka	UTSW	16	17354872	missense	probably benign	0.29
R5857:Pi4ka	UTSW	16	17358984	missense	probably benign	0.00
R5951:Pi4ka	UTSW	16	17303142	missense	probably damaging	1.00
R5953:Pi4ka	UTSW	16	17281951	missense	probably damaging	1.00
R6041:Pi4ka	UTSW	16	17360572	missense	probably benign
R6223:Pi4ka	UTSW	16	17357571	nonsense	probably null
R6416:Pi4ka	UTSW	16	17358322	missense	probably benign	0.22
R6535:Pi4ka	UTSW	16	17301036	missense	probably damaging	1.00
R6580:Pi4ka	UTSW	16	17350830	missense	probably damaging	1.00
R6720:Pi4ka	UTSW	16	17326052	splice site	probably null
R6723:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6725:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6752:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6753:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6755:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6767:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6768:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6782:Pi4ka	UTSW	16	17325988	missense	probably damaging	1.00
R6782:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6788:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6849:Pi4ka	UTSW	16	17303421	missense	possibly damaging	0.54
R6958:Pi4ka	UTSW	16	17325227	missense	probably damaging	1.00
R7014:Pi4ka	UTSW	16	17297067	unclassified	probably benign
R7055:Pi4ka	UTSW	16	17317015	utr 3 prime	probably benign
R7317:Pi4ka	UTSW	16	17405632	critical splice donor site	probably null
R7533:Pi4ka	UTSW	16	17297661	missense
R7552:Pi4ka	UTSW	16	17291216	missense
R7581:Pi4ka	UTSW	16	17301060	missense
R7622:Pi4ka	UTSW	16	17293977	missense
R7717:Pi4ka	UTSW	16	17376923	missense
RF007:Pi4ka	UTSW	16	17297233	missense
U24488:Pi4ka	UTSW	16	17325176	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTGAGTAAGGTCAGCCATGTTGC -3'
(R):5'- ACCCTTTGGTCCCAGGAATCTGTC -3'

Sequencing Primer
(F):5'- CTGTTGGCAATTTGTTGTTCCAC -3'
(R):5'- TCTAGAGAGGCCCTCACTTG -3'

Posted On

2014-03-28