Incidental Mutation 'R1490:Prrc2a'
ID163684
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Nameproline-rich coiled-coil 2A
SynonymsD17H6S51E, G2, 3110039B05Rik, Bat-2, Bat2, Wbp12
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35149076-35164897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35153254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1757 (S1757P)
Ref Sequence ENSEMBL: ENSMUSP00000025253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025253] [ENSMUST00000174805]
Predicted Effect probably benign
Transcript: ENSMUST00000025253
AA Change: S1757P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393
AA Change: S1757P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174386
Predicted Effect unknown
Transcript: ENSMUST00000174805
AA Change: S1702P
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393
AA Change: S1702P

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35154983 missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35156201 missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35153104 missense probably benign 0.00
IGL01618:Prrc2a APN 17 35149553 missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35150667 missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35155591 missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35160504 missense unknown
IGL02683:Prrc2a APN 17 35155993 missense probably benign 0.00
R0145:Prrc2a UTSW 17 35155820 missense probably benign
R0309:Prrc2a UTSW 17 35150915 splice site probably benign
R0441:Prrc2a UTSW 17 35149688 splice site probably benign
R0617:Prrc2a UTSW 17 35153560 missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35156332 missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35157887 missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35153912 splice site probably benign
R1643:Prrc2a UTSW 17 35156954 missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35150707 missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35153308 missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35157908 missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35157429 missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35161068 missense unknown
R2270:Prrc2a UTSW 17 35149536 missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35157498 missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35157932 missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35158497 missense unknown
R4655:Prrc2a UTSW 17 35155614 missense probably benign 0.00
R4792:Prrc2a UTSW 17 35156487 missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4798:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35149998 missense probably benign 0.11
R5129:Prrc2a UTSW 17 35160178 missense unknown
R5155:Prrc2a UTSW 17 35160091 splice site probably null
R5210:Prrc2a UTSW 17 35153620 missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35161047 missense unknown
R5474:Prrc2a UTSW 17 35159213 missense unknown
R5775:Prrc2a UTSW 17 35158487 missense unknown
R5934:Prrc2a UTSW 17 35150084 missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35152740 missense probably benign 0.00
R6291:Prrc2a UTSW 17 35154933 missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35162265 missense unknown
R6622:Prrc2a UTSW 17 35155420 missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35155675 missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35159501 intron probably null
R7026:Prrc2a UTSW 17 35161827 missense unknown
R7059:Prrc2a UTSW 17 35157388 missense probably damaging 0.99
R7489:Prrc2a UTSW 17 35162354 missense unknown
R7502:Prrc2a UTSW 17 35162310 missense unknown
X0011:Prrc2a UTSW 17 35155898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCACTAGGCACAAGTCTGAGTCC -3'
(R):5'- CATCTGGCTCTGAACCCTCTGAAC -3'

Sequencing Primer
(F):5'- GCACAAGTCTGAGTCCTGTAATG -3'
(R):5'- CACCTGCTTCCCATGAAGG -3'
Posted On2014-03-28