Incidental Mutation 'R1490:1700025F22Rik'
Institutional Source Beutler Lab
Gene Symbol 1700025F22Rik
Ensembl Gene ENSMUSG00000024728
Gene NameRIKEN cDNA 1700025F22 gene
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosomal Location11139664-11165320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11141538 bp
Amino Acid Change Isoleucine to Threonine at position 69 (I69T)
Ref Sequence ENSEMBL: ENSMUSP00000137806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078770] [ENSMUST00000180678] [ENSMUST00000181284] [ENSMUST00000181567]
Predicted Effect probably benign
Transcript: ENSMUST00000078770
AA Change: I110T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077828
Gene: ENSMUSG00000024728
AA Change: I110T

Pfam:CD20 17 101 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180678
AA Change: I69T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137968
Gene: ENSMUSG00000024728
AA Change: I69T

transmembrane domain 5 25 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181284
AA Change: I69T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137829
Gene: ENSMUSG00000024728
AA Change: I69T

transmembrane domain 5 25 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181567
AA Change: I69T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137806
Gene: ENSMUSG00000024728
AA Change: I69T

transmembrane domain 5 25 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tmem116 T C 5: 121,495,111 S183P probably damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in 1700025F22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:1700025F22Rik APN 19 11141533 makesense probably null
R0963:1700025F22Rik UTSW 19 11141557 missense possibly damaging 0.94
R5528:1700025F22Rik UTSW 19 11141635 missense possibly damaging 0.90
R6324:1700025F22Rik UTSW 19 11163447 missense probably benign 0.01
R6351:1700025F22Rik UTSW 19 11142401 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctacaccctcagccccAAC -3'
(R):5'- gctggagggagaaatgggac -3'
Posted On2014-03-28