Mutagenetix > Incidental Mutation

Incidental Mutation 'R1491:Rgsl1'

163698

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

039543-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1491 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 153825926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 261 (P261S)

Ref Sequence

ENSEMBL: ENSMUSP00000135642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124558
AA Change: P261S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: P261S

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

probably benign
Transcript: ENSMUST00000185164
AA Change: P296S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: P296S

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730018C14Rik	T	A	12: 112,415,055		noncoding transcript	Het
Acss3	A	G	10: 106,937,308	S606P	probably benign	Het
Adamts13	C	T	2: 26,978,315	T146M	probably damaging	Het
Adora2b	G	A	11: 62,265,537	V271M	probably benign	Het
Agpat5	A	G	8: 18,846,723	Y55C	probably damaging	Het
AI987944	A	C	7: 41,374,348	Y402*	probably null	Het
Angptl4	C	T	17: 33,781,191	A68T	possibly damaging	Het
Ankmy1	T	C	1: 92,886,809	I325M	probably benign	Het
Arfgap2	A	G	2: 91,274,859	K423E	probably damaging	Het
Arfgef3	A	T	10: 18,646,554	S575T	probably damaging	Het
Arhgap24	A	G	5: 102,860,332	I40V	possibly damaging	Het
Arhgef7	T	C	8: 11,819,733		probably null	Het
Arid1a	C	A	4: 133,720,926	S477I	unknown	Het
Armc7	T	C	11: 115,476,203	V58A	probably damaging	Het
Arrdc5	A	T	17: 56,294,222	I301N	probably damaging	Het
Capn15	G	A	17: 25,964,479	P343S	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cgn	C	T	3: 94,763,228	R1002Q	probably damaging	Het
Clstn3	A	T	6: 124,437,490	I759N	possibly damaging	Het
Cops5	A	G	1: 10,034,018	V166A	possibly damaging	Het
Cramp1l	G	T	17: 24,972,349	T1046K	probably benign	Het
Cthrc1	T	G	15: 39,086,677	V143G	probably damaging	Het
Cul9	G	A	17: 46,538,564	Q552*	probably null	Het
Cyp27b1	A	T	10: 127,051,088	D391V	probably damaging	Het
Dcun1d2	A	G	8: 13,281,040	L30S	probably damaging	Het
Dsc3	T	C	18: 19,987,034	E189G	probably damaging	Het
Dst	T	G	1: 34,154,594	S295A	probably damaging	Het
Dusp22	A	G	13: 30,708,815	T192A	probably benign	Het
Esp24	A	T	17: 39,038,285	M1L	probably null	Het
Evc2	G	A	5: 37,393,197		probably null	Het
Fgd6	A	G	10: 94,044,832	N516S	probably benign	Het
Fmn1	T	C	2: 113,596,369	Y1144H	probably damaging	Het
Fut8	T	A	12: 77,448,674	I346K	possibly damaging	Het
Gata3	A	C	2: 9,877,390	V32G	probably damaging	Het
Glrb	A	T	3: 80,911,975	C39S	possibly damaging	Het
Gm16432	C	T	1: 178,015,929	T69I	possibly damaging	Het
Gpr171	A	G	3: 59,097,595	V253A	probably benign	Het
Hdac5	A	G	11: 102,201,253	V670A	probably benign	Het
Hmgxb3	T	C	18: 61,133,908	S1085G	probably benign	Het
Hspa4l	A	G	3: 40,786,794	N746S	probably benign	Het
Hyal5	A	G	6: 24,877,903	T333A	probably benign	Het
Ippk	T	C	13: 49,461,593	V484A	probably benign	Het
Jmjd8	A	T	17: 25,829,292	T33S	possibly damaging	Het
Kctd19	T	A	8: 105,387,062	I660L	possibly damaging	Het
Lrat	A	G	3: 82,903,342	V124A	probably benign	Het
Madcam1	A	G	10: 79,666,524	I281V	probably benign	Het
Mast2	T	A	4: 116,316,491	I455F	possibly damaging	Het
Mroh7	A	G	4: 106,703,058	L683P	probably benign	Het
Myo15b	C	A	11: 115,886,857		probably null	Het
Ncam1	T	C	9: 49,505,549	E814G	probably benign	Het
Ncoa3	A	G	2: 166,055,262	T658A	probably benign	Het
Olfr459	T	C	6: 41,771,522	Y259C	possibly damaging	Het
Olfr53	T	G	7: 140,652,737	Y253D	probably damaging	Het
P2ry13	T	C	3: 59,209,518	K280E	probably damaging	Het
Paqr8	C	A	1: 20,934,824	F67L	probably benign	Het
Pfkfb3	G	T	2: 11,493,936	R37S	probably damaging	Het
Phf14	A	G	6: 11,941,479	D310G	possibly damaging	Het
Phkb	A	G	8: 85,875,657	S26G	possibly damaging	Het
Pkd1l2	T	A	8: 117,028,408	I1684F	probably damaging	Het
Plod2	T	C	9: 92,606,584	V621A	probably benign	Het
Plvap	T	C	8: 71,511,472	N82S	probably damaging	Het
Pomgnt2	A	G	9: 121,982,260	V485A	probably damaging	Het
Psmd9	A	G	5: 123,228,347	E14G	probably benign	Het
Pwwp2b	A	G	7: 139,255,963	E440G	probably damaging	Het
Rasgrp1	G	A	2: 117,282,619	Q771*	probably null	Het
Rft1	C	T	14: 30,666,787	Q223*	probably null	Het
Rgs22	C	A	15: 36,092,901	V409F	probably damaging	Het
Rpl7a	A	G	2: 26,911,115	N38S	probably damaging	Het
Sh3rf2	T	A	18: 42,053,939	F41Y	probably damaging	Het
Spata6	T	A	4: 111,746,191	S34R	probably damaging	Het
Sult2a3	A	T	7: 14,122,942	Y18N	probably benign	Het
Tapt1	A	G	5: 44,218,102		probably null	Het
Tex2	A	T	11: 106,503,640	C615S	possibly damaging	Het
Trim43b	T	C	9: 89,087,612	K261R	possibly damaging	Het
Unc5c	T	A	3: 141,789,822	M484K	probably damaging	Het
Vezf1	T	A	11: 88,073,747	S242T	probably damaging	Het
Vmn2r1	A	G	3: 64,089,613	Y230C	probably damaging	Het
Vmn2r94	A	G	17: 18,257,703	S149P	probably damaging	Het
Wfdc1	T	A	8: 119,666,666		probably null	Het
Zfp975	T	C	7: 42,662,812	T126A	probably benign	Het
Zmym4	T	C	4: 126,882,312		probably null	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGCTTCGCTTGAGAGACTTCTTGAC -3'
(R):5'- ATCCAGAGCTACTGGCTTCCCAAC -3'

Sequencing Primer
(F):5'- CTTGAGAGACTTCTTGACAACCAG -3'
(R):5'- CTTTTACACCCATGCCAAGATG -3'

Posted On

2014-03-28