Incidental Mutation 'R1491:Fmn1'
ID163707
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 039543-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1491 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113596369 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1144 (Y1144H)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect probably damaging
Transcript: ENSMUST00000081349
AA Change: Y1016H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: Y1016H

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099576
AA Change: Y1242H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: Y1242H

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102547
AA Change: Y1242H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: Y1242H

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161731
AA Change: Y1144H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: Y1144H

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185668
AA Change: Y1091H
Meta Mutation Damage Score 0.4476 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,415,055 noncoding transcript Het
Acss3 A G 10: 106,937,308 S606P probably benign Het
Adamts13 C T 2: 26,978,315 T146M probably damaging Het
Adora2b G A 11: 62,265,537 V271M probably benign Het
Agpat5 A G 8: 18,846,723 Y55C probably damaging Het
AI987944 A C 7: 41,374,348 Y402* probably null Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Arfgap2 A G 2: 91,274,859 K423E probably damaging Het
Arfgef3 A T 10: 18,646,554 S575T probably damaging Het
Arhgap24 A G 5: 102,860,332 I40V possibly damaging Het
Arhgef7 T C 8: 11,819,733 probably null Het
Arid1a C A 4: 133,720,926 S477I unknown Het
Armc7 T C 11: 115,476,203 V58A probably damaging Het
Arrdc5 A T 17: 56,294,222 I301N probably damaging Het
Capn15 G A 17: 25,964,479 P343S probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cgn C T 3: 94,763,228 R1002Q probably damaging Het
Clstn3 A T 6: 124,437,490 I759N possibly damaging Het
Cops5 A G 1: 10,034,018 V166A possibly damaging Het
Cramp1l G T 17: 24,972,349 T1046K probably benign Het
Cthrc1 T G 15: 39,086,677 V143G probably damaging Het
Cul9 G A 17: 46,538,564 Q552* probably null Het
Cyp27b1 A T 10: 127,051,088 D391V probably damaging Het
Dcun1d2 A G 8: 13,281,040 L30S probably damaging Het
Dsc3 T C 18: 19,987,034 E189G probably damaging Het
Dst T G 1: 34,154,594 S295A probably damaging Het
Dusp22 A G 13: 30,708,815 T192A probably benign Het
Esp24 A T 17: 39,038,285 M1L probably null Het
Evc2 G A 5: 37,393,197 probably null Het
Fgd6 A G 10: 94,044,832 N516S probably benign Het
Fut8 T A 12: 77,448,674 I346K possibly damaging Het
Gata3 A C 2: 9,877,390 V32G probably damaging Het
Glrb A T 3: 80,911,975 C39S possibly damaging Het
Gm16432 C T 1: 178,015,929 T69I possibly damaging Het
Gpr171 A G 3: 59,097,595 V253A probably benign Het
Hdac5 A G 11: 102,201,253 V670A probably benign Het
Hmgxb3 T C 18: 61,133,908 S1085G probably benign Het
Hspa4l A G 3: 40,786,794 N746S probably benign Het
Hyal5 A G 6: 24,877,903 T333A probably benign Het
Ippk T C 13: 49,461,593 V484A probably benign Het
Jmjd8 A T 17: 25,829,292 T33S possibly damaging Het
Kctd19 T A 8: 105,387,062 I660L possibly damaging Het
Lrat A G 3: 82,903,342 V124A probably benign Het
Madcam1 A G 10: 79,666,524 I281V probably benign Het
Mast2 T A 4: 116,316,491 I455F possibly damaging Het
Mroh7 A G 4: 106,703,058 L683P probably benign Het
Myo15b C A 11: 115,886,857 probably null Het
Ncam1 T C 9: 49,505,549 E814G probably benign Het
Ncoa3 A G 2: 166,055,262 T658A probably benign Het
Olfr459 T C 6: 41,771,522 Y259C possibly damaging Het
Olfr53 T G 7: 140,652,737 Y253D probably damaging Het
P2ry13 T C 3: 59,209,518 K280E probably damaging Het
Paqr8 C A 1: 20,934,824 F67L probably benign Het
Pfkfb3 G T 2: 11,493,936 R37S probably damaging Het
Phf14 A G 6: 11,941,479 D310G possibly damaging Het
Phkb A G 8: 85,875,657 S26G possibly damaging Het
Pkd1l2 T A 8: 117,028,408 I1684F probably damaging Het
Plod2 T C 9: 92,606,584 V621A probably benign Het
Plvap T C 8: 71,511,472 N82S probably damaging Het
Pomgnt2 A G 9: 121,982,260 V485A probably damaging Het
Psmd9 A G 5: 123,228,347 E14G probably benign Het
Pwwp2b A G 7: 139,255,963 E440G probably damaging Het
Rasgrp1 G A 2: 117,282,619 Q771* probably null Het
Rft1 C T 14: 30,666,787 Q223* probably null Het
Rgs22 C A 15: 36,092,901 V409F probably damaging Het
Rgsl1 G A 1: 153,825,926 P261S possibly damaging Het
Rpl7a A G 2: 26,911,115 N38S probably damaging Het
Sh3rf2 T A 18: 42,053,939 F41Y probably damaging Het
Spata6 T A 4: 111,746,191 S34R probably damaging Het
Sult2a3 A T 7: 14,122,942 Y18N probably benign Het
Tapt1 A G 5: 44,218,102 probably null Het
Tex2 A T 11: 106,503,640 C615S possibly damaging Het
Trim43b T C 9: 89,087,612 K261R possibly damaging Het
Unc5c T A 3: 141,789,822 M484K probably damaging Het
Vezf1 T A 11: 88,073,747 S242T probably damaging Het
Vmn2r1 A G 3: 64,089,613 Y230C probably damaging Het
Vmn2r94 A G 17: 18,257,703 S149P probably damaging Het
Wfdc1 T A 8: 119,666,666 probably null Het
Zfp975 T C 7: 42,662,812 T126A probably benign Het
Zmym4 T C 4: 126,882,312 probably null Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCACGCCATTAAGAGCACACATTTTC -3'
(R):5'- AAGGTAGCTTGATATGCAGCAGCC -3'

Sequencing Primer
(F):5'- gtttgcttgcttgcctatttg -3'
(R):5'- AGGGTCTTTCAGACATTTCCTC -3'
Posted On2014-03-28