Incidental Mutation 'R1491:Ncoa3'
ID163709
Institutional Source Beutler Lab
Gene Symbol Ncoa3
Ensembl Gene ENSMUSG00000027678
Gene Namenuclear receptor coactivator 3
SynonymsTRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik
MMRRC Submission 039543-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1491 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165992636-166073242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166055262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 658 (T658A)
Ref Sequence ENSEMBL: ENSMUSP00000104875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088095] [ENSMUST00000109252]
Predicted Effect probably benign
Transcript: ENSMUST00000088095
AA Change: T658A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: T658A

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109252
AA Change: T658A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: T658A

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 4.1e-34 PFAM
low complexity region 438 467 N/A INTRINSIC
low complexity region 502 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 3.5e-28 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1106 6.6e-29 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
low complexity region 1242 1262 N/A INTRINSIC
DUF1518 1269 1326 1.08e-21 SMART
low complexity region 1383 1397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153507
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,415,055 noncoding transcript Het
Acss3 A G 10: 106,937,308 S606P probably benign Het
Adamts13 C T 2: 26,978,315 T146M probably damaging Het
Adora2b G A 11: 62,265,537 V271M probably benign Het
Agpat5 A G 8: 18,846,723 Y55C probably damaging Het
AI987944 A C 7: 41,374,348 Y402* probably null Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Arfgap2 A G 2: 91,274,859 K423E probably damaging Het
Arfgef3 A T 10: 18,646,554 S575T probably damaging Het
Arhgap24 A G 5: 102,860,332 I40V possibly damaging Het
Arhgef7 T C 8: 11,819,733 probably null Het
Arid1a C A 4: 133,720,926 S477I unknown Het
Armc7 T C 11: 115,476,203 V58A probably damaging Het
Arrdc5 A T 17: 56,294,222 I301N probably damaging Het
Capn15 G A 17: 25,964,479 P343S probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cgn C T 3: 94,763,228 R1002Q probably damaging Het
Clstn3 A T 6: 124,437,490 I759N possibly damaging Het
Cops5 A G 1: 10,034,018 V166A possibly damaging Het
Cramp1l G T 17: 24,972,349 T1046K probably benign Het
Cthrc1 T G 15: 39,086,677 V143G probably damaging Het
Cul9 G A 17: 46,538,564 Q552* probably null Het
Cyp27b1 A T 10: 127,051,088 D391V probably damaging Het
Dcun1d2 A G 8: 13,281,040 L30S probably damaging Het
Dsc3 T C 18: 19,987,034 E189G probably damaging Het
Dst T G 1: 34,154,594 S295A probably damaging Het
Dusp22 A G 13: 30,708,815 T192A probably benign Het
Esp24 A T 17: 39,038,285 M1L probably null Het
Evc2 G A 5: 37,393,197 probably null Het
Fgd6 A G 10: 94,044,832 N516S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Fut8 T A 12: 77,448,674 I346K possibly damaging Het
Gata3 A C 2: 9,877,390 V32G probably damaging Het
Glrb A T 3: 80,911,975 C39S possibly damaging Het
Gm16432 C T 1: 178,015,929 T69I possibly damaging Het
Gpr171 A G 3: 59,097,595 V253A probably benign Het
Hdac5 A G 11: 102,201,253 V670A probably benign Het
Hmgxb3 T C 18: 61,133,908 S1085G probably benign Het
Hspa4l A G 3: 40,786,794 N746S probably benign Het
Hyal5 A G 6: 24,877,903 T333A probably benign Het
Ippk T C 13: 49,461,593 V484A probably benign Het
Jmjd8 A T 17: 25,829,292 T33S possibly damaging Het
Kctd19 T A 8: 105,387,062 I660L possibly damaging Het
Lrat A G 3: 82,903,342 V124A probably benign Het
Madcam1 A G 10: 79,666,524 I281V probably benign Het
Mast2 T A 4: 116,316,491 I455F possibly damaging Het
Mroh7 A G 4: 106,703,058 L683P probably benign Het
Myo15b C A 11: 115,886,857 probably null Het
Ncam1 T C 9: 49,505,549 E814G probably benign Het
Olfr459 T C 6: 41,771,522 Y259C possibly damaging Het
Olfr53 T G 7: 140,652,737 Y253D probably damaging Het
P2ry13 T C 3: 59,209,518 K280E probably damaging Het
Paqr8 C A 1: 20,934,824 F67L probably benign Het
Pfkfb3 G T 2: 11,493,936 R37S probably damaging Het
Phf14 A G 6: 11,941,479 D310G possibly damaging Het
Phkb A G 8: 85,875,657 S26G possibly damaging Het
Pkd1l2 T A 8: 117,028,408 I1684F probably damaging Het
Plod2 T C 9: 92,606,584 V621A probably benign Het
Plvap T C 8: 71,511,472 N82S probably damaging Het
Pomgnt2 A G 9: 121,982,260 V485A probably damaging Het
Psmd9 A G 5: 123,228,347 E14G probably benign Het
Pwwp2b A G 7: 139,255,963 E440G probably damaging Het
Rasgrp1 G A 2: 117,282,619 Q771* probably null Het
Rft1 C T 14: 30,666,787 Q223* probably null Het
Rgs22 C A 15: 36,092,901 V409F probably damaging Het
Rgsl1 G A 1: 153,825,926 P261S possibly damaging Het
Rpl7a A G 2: 26,911,115 N38S probably damaging Het
Sh3rf2 T A 18: 42,053,939 F41Y probably damaging Het
Spata6 T A 4: 111,746,191 S34R probably damaging Het
Sult2a3 A T 7: 14,122,942 Y18N probably benign Het
Tapt1 A G 5: 44,218,102 probably null Het
Tex2 A T 11: 106,503,640 C615S possibly damaging Het
Trim43b T C 9: 89,087,612 K261R possibly damaging Het
Unc5c T A 3: 141,789,822 M484K probably damaging Het
Vezf1 T A 11: 88,073,747 S242T probably damaging Het
Vmn2r1 A G 3: 64,089,613 Y230C probably damaging Het
Vmn2r94 A G 17: 18,257,703 S149P probably damaging Het
Wfdc1 T A 8: 119,666,666 probably null Het
Zfp975 T C 7: 42,662,812 T126A probably benign Het
Zmym4 T C 4: 126,882,312 probably null Het
Other mutations in Ncoa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ncoa3 APN 2 166051609 splice site probably null
IGL01068:Ncoa3 APN 2 166052795 missense probably damaging 1.00
IGL01300:Ncoa3 APN 2 166068461 missense probably benign 0.41
IGL01336:Ncoa3 APN 2 166054523 missense probably benign
IGL01533:Ncoa3 APN 2 166055025 missense probably benign 0.03
IGL01658:Ncoa3 APN 2 166051302 splice site probably benign
IGL02053:Ncoa3 APN 2 166054834 missense probably damaging 1.00
IGL02138:Ncoa3 APN 2 166055262 missense probably benign
IGL02167:Ncoa3 APN 2 166070136 missense probably damaging 1.00
IGL02217:Ncoa3 APN 2 166055346 missense probably damaging 1.00
IGL02312:Ncoa3 APN 2 166057200 missense probably benign 0.10
IGL02381:Ncoa3 APN 2 166052817 missense probably damaging 1.00
IGL02568:Ncoa3 APN 2 166069357 missense probably damaging 1.00
IGL02658:Ncoa3 APN 2 166051393 missense probably benign 0.01
IGL02806:Ncoa3 APN 2 166052432 missense probably benign 0.25
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0333:Ncoa3 UTSW 2 166054291 missense probably damaging 1.00
R0379:Ncoa3 UTSW 2 166054502 missense probably damaging 0.97
R0411:Ncoa3 UTSW 2 166068543 missense probably benign 0.31
R0734:Ncoa3 UTSW 2 166069191 unclassified probably benign
R1434:Ncoa3 UTSW 2 166055510 missense probably benign 0.01
R1721:Ncoa3 UTSW 2 166069301 missense possibly damaging 0.55
R1895:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R1896:Ncoa3 UTSW 2 166048464 missense probably benign 0.36
R1946:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R2406:Ncoa3 UTSW 2 166055359 missense probably damaging 1.00
R3800:Ncoa3 UTSW 2 166059719 missense possibly damaging 0.58
R3825:Ncoa3 UTSW 2 166054798 missense possibly damaging 0.83
R4377:Ncoa3 UTSW 2 166054497 missense possibly damaging 0.50
R4674:Ncoa3 UTSW 2 166059811 missense probably benign
R4706:Ncoa3 UTSW 2 166047879 missense probably damaging 1.00
R4751:Ncoa3 UTSW 2 166069903 missense possibly damaging 0.81
R4954:Ncoa3 UTSW 2 166065786 missense probably benign
R4976:Ncoa3 UTSW 2 166047900 missense probably damaging 1.00
R4992:Ncoa3 UTSW 2 166069939 missense probably benign 0.39
R5100:Ncoa3 UTSW 2 166050097 missense probably damaging 1.00
R5578:Ncoa3 UTSW 2 166054328 missense probably benign 0.00
R5932:Ncoa3 UTSW 2 166070125 splice site probably null
R6051:Ncoa3 UTSW 2 166058765 missense probably damaging 1.00
R6370:Ncoa3 UTSW 2 166065905 missense probably benign 0.00
R6372:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R6373:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R7438:Ncoa3 UTSW 2 166068529 missense probably damaging 1.00
R7660:Ncoa3 UTSW 2 166069321 missense probably benign 0.00
R7738:Ncoa3 UTSW 2 166050067 missense probably damaging 1.00
R7752:Ncoa3 UTSW 2 166065768 nonsense probably null
X0018:Ncoa3 UTSW 2 166054802 missense possibly damaging 0.58
Z1177:Ncoa3 UTSW 2 166048508 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGTGTCAGTCAAACAGCAGAG -3'
(R):5'- TTTGGCAAGCACATCACTGGGG -3'

Sequencing Primer
(F):5'- GTGTCAGAGACGCCCAG -3'
(R):5'- AGCACATCACTGGGGTCATC -3'
Posted On2014-03-28