Incidental Mutation 'R1491:Hspa4l'
ID 163711
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 039543-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R1491 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40741226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 746 (N746S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably benign
Transcript: ENSMUST00000077083
AA Change: N746S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: N746S

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108086
AA Change: N725S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: N725S

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: N746S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: N746S

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,381,489 (GRCm39) noncoding transcript Het
Acss3 A G 10: 106,773,169 (GRCm39) S606P probably benign Het
Adamts13 C T 2: 26,868,327 (GRCm39) T146M probably damaging Het
Adora2b G A 11: 62,156,363 (GRCm39) V271M probably benign Het
Agpat5 A G 8: 18,896,739 (GRCm39) Y55C probably damaging Het
AI987944 A C 7: 41,023,772 (GRCm39) Y402* probably null Het
Angptl4 C T 17: 34,000,165 (GRCm39) A68T possibly damaging Het
Ankmy1 T C 1: 92,814,531 (GRCm39) I325M probably benign Het
Arfgap2 A G 2: 91,105,204 (GRCm39) K423E probably damaging Het
Arfgef3 A T 10: 18,522,302 (GRCm39) S575T probably damaging Het
Arhgap24 A G 5: 103,008,198 (GRCm39) I40V possibly damaging Het
Arhgef7 T C 8: 11,869,733 (GRCm39) probably null Het
Arid1a C A 4: 133,448,237 (GRCm39) S477I unknown Het
Armc7 T C 11: 115,367,029 (GRCm39) V58A probably damaging Het
Arrdc5 A T 17: 56,601,222 (GRCm39) I301N probably damaging Het
Capn15 G A 17: 26,183,453 (GRCm39) P343S probably damaging Het
Catspere2 C T 1: 177,843,495 (GRCm39) T69I possibly damaging Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Cgn C T 3: 94,670,535 (GRCm39) R1002Q probably damaging Het
Clstn3 A T 6: 124,414,449 (GRCm39) I759N possibly damaging Het
Cops5 A G 1: 10,104,243 (GRCm39) V166A possibly damaging Het
Cramp1 G T 17: 25,191,323 (GRCm39) T1046K probably benign Het
Cthrc1 T G 15: 38,950,072 (GRCm39) V143G probably damaging Het
Cul9 G A 17: 46,849,490 (GRCm39) Q552* probably null Het
Cyp27b1 A T 10: 126,886,957 (GRCm39) D391V probably damaging Het
Dcun1d2 A G 8: 13,331,040 (GRCm39) L30S probably damaging Het
Dsc3 T C 18: 20,120,091 (GRCm39) E189G probably damaging Het
Dst T G 1: 34,193,675 (GRCm39) S295A probably damaging Het
Dusp22 A G 13: 30,892,798 (GRCm39) T192A probably benign Het
Esp24 A T 17: 39,349,176 (GRCm39) M1L probably null Het
Evc2 G A 5: 37,550,541 (GRCm39) probably null Het
Fgd6 A G 10: 93,880,694 (GRCm39) N516S probably benign Het
Fmn1 T C 2: 113,426,714 (GRCm39) Y1144H probably damaging Het
Fut8 T A 12: 77,495,448 (GRCm39) I346K possibly damaging Het
Gata3 A C 2: 9,882,201 (GRCm39) V32G probably damaging Het
Glrb A T 3: 80,819,282 (GRCm39) C39S possibly damaging Het
Gpr171 A G 3: 59,005,016 (GRCm39) V253A probably benign Het
Hdac5 A G 11: 102,092,079 (GRCm39) V670A probably benign Het
Hmgxb3 T C 18: 61,266,980 (GRCm39) S1085G probably benign Het
Hyal5 A G 6: 24,877,902 (GRCm39) T333A probably benign Het
Ippk T C 13: 49,615,069 (GRCm39) V484A probably benign Het
Jmjd8 A T 17: 26,048,266 (GRCm39) T33S possibly damaging Het
Kctd19 T A 8: 106,113,694 (GRCm39) I660L possibly damaging Het
Lrat A G 3: 82,810,649 (GRCm39) V124A probably benign Het
Madcam1 A G 10: 79,502,358 (GRCm39) I281V probably benign Het
Mast2 T A 4: 116,173,688 (GRCm39) I455F possibly damaging Het
Mroh7 A G 4: 106,560,255 (GRCm39) L683P probably benign Het
Myo15b C A 11: 115,777,683 (GRCm39) probably null Het
Ncam1 T C 9: 49,416,849 (GRCm39) E814G probably benign Het
Ncoa3 A G 2: 165,897,182 (GRCm39) T658A probably benign Het
Or13a20 T G 7: 140,232,650 (GRCm39) Y253D probably damaging Het
Or9a2 T C 6: 41,748,456 (GRCm39) Y259C possibly damaging Het
P2ry13 T C 3: 59,116,939 (GRCm39) K280E probably damaging Het
Paqr8 C A 1: 21,005,048 (GRCm39) F67L probably benign Het
Pfkfb3 G T 2: 11,498,747 (GRCm39) R37S probably damaging Het
Phf14 A G 6: 11,941,478 (GRCm39) D310G possibly damaging Het
Phkb A G 8: 86,602,286 (GRCm39) S26G possibly damaging Het
Pkd1l2 T A 8: 117,755,147 (GRCm39) I1684F probably damaging Het
Plod2 T C 9: 92,488,637 (GRCm39) V621A probably benign Het
Plvap T C 8: 71,964,116 (GRCm39) N82S probably damaging Het
Pomgnt2 A G 9: 121,811,326 (GRCm39) V485A probably damaging Het
Psmd9 A G 5: 123,366,410 (GRCm39) E14G probably benign Het
Pwwp2b A G 7: 138,835,879 (GRCm39) E440G probably damaging Het
Rasgrp1 G A 2: 117,113,100 (GRCm39) Q771* probably null Het
Rft1 C T 14: 30,388,744 (GRCm39) Q223* probably null Het
Rgs22 C A 15: 36,093,047 (GRCm39) V409F probably damaging Het
Rgsl1 G A 1: 153,701,672 (GRCm39) P261S possibly damaging Het
Rpl7a A G 2: 26,801,127 (GRCm39) N38S probably damaging Het
Sh3rf2 T A 18: 42,187,004 (GRCm39) F41Y probably damaging Het
Spata6 T A 4: 111,603,388 (GRCm39) S34R probably damaging Het
Sult2a3 A T 7: 13,856,867 (GRCm39) Y18N probably benign Het
Tapt1 A G 5: 44,375,444 (GRCm39) probably null Het
Tex2 A T 11: 106,394,466 (GRCm39) C615S possibly damaging Het
Trim43b T C 9: 88,969,665 (GRCm39) K261R possibly damaging Het
Unc5c T A 3: 141,495,583 (GRCm39) M484K probably damaging Het
Vezf1 T A 11: 87,964,573 (GRCm39) S242T probably damaging Het
Vmn2r1 A G 3: 63,997,034 (GRCm39) Y230C probably damaging Het
Vmn2r94 A G 17: 18,477,965 (GRCm39) S149P probably damaging Het
Wfdc1 T A 8: 120,393,405 (GRCm39) probably null Het
Zfp975 T C 7: 42,312,236 (GRCm39) T126A probably benign Het
Zmym4 T C 4: 126,776,105 (GRCm39) probably null Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGAGTCCTTTGGAAATCTGCAC -3'
(R):5'- CCATTACACCTAGAGTGAAGCCAGC -3'

Sequencing Primer
(F):5'- CCTTTGGAAATCTGCACTGATTTTAC -3'
(R):5'- aaagttgtcctctgccctc -3'
Posted On 2014-03-28