Incidental Mutation 'R1491:Evc2'
ID163727
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission 039543-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1491 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 37393197 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect probably null
Transcript: ENSMUST00000056365
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159915
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,415,055 noncoding transcript Het
Acss3 A G 10: 106,937,308 S606P probably benign Het
Adamts13 C T 2: 26,978,315 T146M probably damaging Het
Adora2b G A 11: 62,265,537 V271M probably benign Het
Agpat5 A G 8: 18,846,723 Y55C probably damaging Het
AI987944 A C 7: 41,374,348 Y402* probably null Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Arfgap2 A G 2: 91,274,859 K423E probably damaging Het
Arfgef3 A T 10: 18,646,554 S575T probably damaging Het
Arhgap24 A G 5: 102,860,332 I40V possibly damaging Het
Arhgef7 T C 8: 11,819,733 probably null Het
Arid1a C A 4: 133,720,926 S477I unknown Het
Armc7 T C 11: 115,476,203 V58A probably damaging Het
Arrdc5 A T 17: 56,294,222 I301N probably damaging Het
Capn15 G A 17: 25,964,479 P343S probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cgn C T 3: 94,763,228 R1002Q probably damaging Het
Clstn3 A T 6: 124,437,490 I759N possibly damaging Het
Cops5 A G 1: 10,034,018 V166A possibly damaging Het
Cramp1l G T 17: 24,972,349 T1046K probably benign Het
Cthrc1 T G 15: 39,086,677 V143G probably damaging Het
Cul9 G A 17: 46,538,564 Q552* probably null Het
Cyp27b1 A T 10: 127,051,088 D391V probably damaging Het
Dcun1d2 A G 8: 13,281,040 L30S probably damaging Het
Dsc3 T C 18: 19,987,034 E189G probably damaging Het
Dst T G 1: 34,154,594 S295A probably damaging Het
Dusp22 A G 13: 30,708,815 T192A probably benign Het
Esp24 A T 17: 39,038,285 M1L probably null Het
Fgd6 A G 10: 94,044,832 N516S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Fut8 T A 12: 77,448,674 I346K possibly damaging Het
Gata3 A C 2: 9,877,390 V32G probably damaging Het
Glrb A T 3: 80,911,975 C39S possibly damaging Het
Gm16432 C T 1: 178,015,929 T69I possibly damaging Het
Gpr171 A G 3: 59,097,595 V253A probably benign Het
Hdac5 A G 11: 102,201,253 V670A probably benign Het
Hmgxb3 T C 18: 61,133,908 S1085G probably benign Het
Hspa4l A G 3: 40,786,794 N746S probably benign Het
Hyal5 A G 6: 24,877,903 T333A probably benign Het
Ippk T C 13: 49,461,593 V484A probably benign Het
Jmjd8 A T 17: 25,829,292 T33S possibly damaging Het
Kctd19 T A 8: 105,387,062 I660L possibly damaging Het
Lrat A G 3: 82,903,342 V124A probably benign Het
Madcam1 A G 10: 79,666,524 I281V probably benign Het
Mast2 T A 4: 116,316,491 I455F possibly damaging Het
Mroh7 A G 4: 106,703,058 L683P probably benign Het
Myo15b C A 11: 115,886,857 probably null Het
Ncam1 T C 9: 49,505,549 E814G probably benign Het
Ncoa3 A G 2: 166,055,262 T658A probably benign Het
Olfr459 T C 6: 41,771,522 Y259C possibly damaging Het
Olfr53 T G 7: 140,652,737 Y253D probably damaging Het
P2ry13 T C 3: 59,209,518 K280E probably damaging Het
Paqr8 C A 1: 20,934,824 F67L probably benign Het
Pfkfb3 G T 2: 11,493,936 R37S probably damaging Het
Phf14 A G 6: 11,941,479 D310G possibly damaging Het
Phkb A G 8: 85,875,657 S26G possibly damaging Het
Pkd1l2 T A 8: 117,028,408 I1684F probably damaging Het
Plod2 T C 9: 92,606,584 V621A probably benign Het
Plvap T C 8: 71,511,472 N82S probably damaging Het
Pomgnt2 A G 9: 121,982,260 V485A probably damaging Het
Psmd9 A G 5: 123,228,347 E14G probably benign Het
Pwwp2b A G 7: 139,255,963 E440G probably damaging Het
Rasgrp1 G A 2: 117,282,619 Q771* probably null Het
Rft1 C T 14: 30,666,787 Q223* probably null Het
Rgs22 C A 15: 36,092,901 V409F probably damaging Het
Rgsl1 G A 1: 153,825,926 P261S possibly damaging Het
Rpl7a A G 2: 26,911,115 N38S probably damaging Het
Sh3rf2 T A 18: 42,053,939 F41Y probably damaging Het
Spata6 T A 4: 111,746,191 S34R probably damaging Het
Sult2a3 A T 7: 14,122,942 Y18N probably benign Het
Tapt1 A G 5: 44,218,102 probably null Het
Tex2 A T 11: 106,503,640 C615S possibly damaging Het
Trim43b T C 9: 89,087,612 K261R possibly damaging Het
Unc5c T A 3: 141,789,822 M484K probably damaging Het
Vezf1 T A 11: 88,073,747 S242T probably damaging Het
Vmn2r1 A G 3: 64,089,613 Y230C probably damaging Het
Vmn2r94 A G 17: 18,257,703 S149P probably damaging Het
Wfdc1 T A 8: 119,666,666 probably null Het
Zfp975 T C 7: 42,662,812 T126A probably benign Het
Zmym4 T C 4: 126,882,312 probably null Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1662:Evc2 UTSW 5 37348750 missense probably benign 0.00
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3953:Evc2 UTSW 5 37380587 critical splice donor site probably null
R3959:Evc2 UTSW 5 37415776 missense possibly damaging 0.63
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5847:Evc2 UTSW 5 37404724 intron probably benign
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7144:Evc2 UTSW 5 37386839 missense probably damaging 0.97
R7372:Evc2 UTSW 5 37387133 missense probably damaging 0.98
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
R7607:Evc2 UTSW 5 37386856 missense possibly damaging 0.94
R7915:Evc2 UTSW 5 37386862 missense probably damaging 0.98
R8144:Evc2 UTSW 5 37380567 missense probably damaging 1.00
R8506:Evc2 UTSW 5 37383142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGAAGCCAGCATCTCCTCTGAC -3'
(R):5'- CAGGGCTACCCATTTTCTTCCACAG -3'

Sequencing Primer
(F):5'- AGCATCTCCTCTGACCTGTC -3'
(R):5'- AATGGCCCCAATCAGTCTGTG -3'
Posted On2014-03-28