Incidental Mutation 'R1491:Cthrc1'
ID 163774
Institutional Source Beutler Lab
Gene Symbol Cthrc1
Ensembl Gene ENSMUSG00000054196
Gene Name collagen triple helix repeat containing 1
Synonyms 1110014B07Rik
MMRRC Submission 039543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1491 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 39076932-39087121 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 39086677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 143 (V143G)
Ref Sequence ENSEMBL: ENSMUSP00000153886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022908] [ENSMUST00000067072] [ENSMUST00000226433]
AlphaFold Q9D1D6
Predicted Effect probably benign
Transcript: ENSMUST00000022908
SMART Domains Protein: ENSMUSP00000022908
Gene: ENSMUSG00000022299

low complexity region 3 16 N/A INTRINSIC
Pfam:Mito_carr 20 113 4.5e-24 PFAM
Pfam:Mito_carr 116 214 1e-24 PFAM
Pfam:Mito_carr 220 311 3.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067072
AA Change: V217G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070018
Gene: ENSMUSG00000054196
AA Change: V217G

signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144800
Predicted Effect probably damaging
Transcript: ENSMUST00000226433
AA Change: V143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Adult mice homozygous for a null allele exhibit decreased bone, decreased osteoblast number and decreased bone formation. Mice homozygous for a different knock-out allele exhibit increased hepatocyte size, decreased cell density in the liver, hepatic steatosis and increased glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,415,055 noncoding transcript Het
Acss3 A G 10: 106,937,308 S606P probably benign Het
Adamts13 C T 2: 26,978,315 T146M probably damaging Het
Adora2b G A 11: 62,265,537 V271M probably benign Het
Agpat5 A G 8: 18,846,723 Y55C probably damaging Het
AI987944 A C 7: 41,374,348 Y402* probably null Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Arfgap2 A G 2: 91,274,859 K423E probably damaging Het
Arfgef3 A T 10: 18,646,554 S575T probably damaging Het
Arhgap24 A G 5: 102,860,332 I40V possibly damaging Het
Arhgef7 T C 8: 11,819,733 probably null Het
Arid1a C A 4: 133,720,926 S477I unknown Het
Armc7 T C 11: 115,476,203 V58A probably damaging Het
Arrdc5 A T 17: 56,294,222 I301N probably damaging Het
Capn15 G A 17: 25,964,479 P343S probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cgn C T 3: 94,763,228 R1002Q probably damaging Het
Clstn3 A T 6: 124,437,490 I759N possibly damaging Het
Cops5 A G 1: 10,034,018 V166A possibly damaging Het
Cramp1l G T 17: 24,972,349 T1046K probably benign Het
Cul9 G A 17: 46,538,564 Q552* probably null Het
Cyp27b1 A T 10: 127,051,088 D391V probably damaging Het
Dcun1d2 A G 8: 13,281,040 L30S probably damaging Het
Dsc3 T C 18: 19,987,034 E189G probably damaging Het
Dst T G 1: 34,154,594 S295A probably damaging Het
Dusp22 A G 13: 30,708,815 T192A probably benign Het
Esp24 A T 17: 39,038,285 M1L probably null Het
Evc2 G A 5: 37,393,197 probably null Het
Fgd6 A G 10: 94,044,832 N516S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Fut8 T A 12: 77,448,674 I346K possibly damaging Het
Gata3 A C 2: 9,877,390 V32G probably damaging Het
Glrb A T 3: 80,911,975 C39S possibly damaging Het
Gm16432 C T 1: 178,015,929 T69I possibly damaging Het
Gpr171 A G 3: 59,097,595 V253A probably benign Het
Hdac5 A G 11: 102,201,253 V670A probably benign Het
Hmgxb3 T C 18: 61,133,908 S1085G probably benign Het
Hspa4l A G 3: 40,786,794 N746S probably benign Het
Hyal5 A G 6: 24,877,903 T333A probably benign Het
Ippk T C 13: 49,461,593 V484A probably benign Het
Jmjd8 A T 17: 25,829,292 T33S possibly damaging Het
Kctd19 T A 8: 105,387,062 I660L possibly damaging Het
Lrat A G 3: 82,903,342 V124A probably benign Het
Madcam1 A G 10: 79,666,524 I281V probably benign Het
Mast2 T A 4: 116,316,491 I455F possibly damaging Het
Mroh7 A G 4: 106,703,058 L683P probably benign Het
Myo15b C A 11: 115,886,857 probably null Het
Ncam1 T C 9: 49,505,549 E814G probably benign Het
Ncoa3 A G 2: 166,055,262 T658A probably benign Het
Olfr459 T C 6: 41,771,522 Y259C possibly damaging Het
Olfr53 T G 7: 140,652,737 Y253D probably damaging Het
P2ry13 T C 3: 59,209,518 K280E probably damaging Het
Paqr8 C A 1: 20,934,824 F67L probably benign Het
Pfkfb3 G T 2: 11,493,936 R37S probably damaging Het
Phf14 A G 6: 11,941,479 D310G possibly damaging Het
Phkb A G 8: 85,875,657 S26G possibly damaging Het
Pkd1l2 T A 8: 117,028,408 I1684F probably damaging Het
Plod2 T C 9: 92,606,584 V621A probably benign Het
Plvap T C 8: 71,511,472 N82S probably damaging Het
Pomgnt2 A G 9: 121,982,260 V485A probably damaging Het
Psmd9 A G 5: 123,228,347 E14G probably benign Het
Pwwp2b A G 7: 139,255,963 E440G probably damaging Het
Rasgrp1 G A 2: 117,282,619 Q771* probably null Het
Rft1 C T 14: 30,666,787 Q223* probably null Het
Rgs22 C A 15: 36,092,901 V409F probably damaging Het
Rgsl1 G A 1: 153,825,926 P261S possibly damaging Het
Rpl7a A G 2: 26,911,115 N38S probably damaging Het
Sh3rf2 T A 18: 42,053,939 F41Y probably damaging Het
Spata6 T A 4: 111,746,191 S34R probably damaging Het
Sult2a3 A T 7: 14,122,942 Y18N probably benign Het
Tapt1 A G 5: 44,218,102 probably null Het
Tex2 A T 11: 106,503,640 C615S possibly damaging Het
Trim43b T C 9: 89,087,612 K261R possibly damaging Het
Unc5c T A 3: 141,789,822 M484K probably damaging Het
Vezf1 T A 11: 88,073,747 S242T probably damaging Het
Vmn2r1 A G 3: 64,089,613 Y230C probably damaging Het
Vmn2r94 A G 17: 18,257,703 S149P probably damaging Het
Wfdc1 T A 8: 119,666,666 probably null Het
Zfp975 T C 7: 42,662,812 T126A probably benign Het
Zmym4 T C 4: 126,882,312 probably null Het
Other mutations in Cthrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cthrc1 APN 15 39080499 missense possibly damaging 0.95
IGL02532:Cthrc1 APN 15 39077165 splice site probably benign
IGL02954:Cthrc1 APN 15 39076994 utr 5 prime probably benign
IGL03390:Cthrc1 APN 15 39077134 missense probably benign 0.00
R0390:Cthrc1 UTSW 15 39086764 makesense probably null
R0594:Cthrc1 UTSW 15 39077142 missense possibly damaging 0.95
R4454:Cthrc1 UTSW 15 39077013 missense probably benign 0.18
R5096:Cthrc1 UTSW 15 39084420 missense probably damaging 0.99
R5860:Cthrc1 UTSW 15 39086685 missense probably damaging 1.00
R7082:Cthrc1 UTSW 15 39077100 missense probably benign
R7717:Cthrc1 UTSW 15 39077116 missense probably benign
R7983:Cthrc1 UTSW 15 39077155 missense probably benign 0.00
R8710:Cthrc1 UTSW 15 39084426 missense probably damaging 1.00
R8812:Cthrc1 UTSW 15 39084471 missense probably damaging 1.00
R8889:Cthrc1 UTSW 15 39077050 missense probably damaging 0.99
R9449:Cthrc1 UTSW 15 39084473 missense probably benign 0.19
R9467:Cthrc1 UTSW 15 39084294 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gggctacacaatcaaacaaataaac -3'
Posted On 2014-03-28