Incidental Mutation 'R1494:Dcaf6'
Institutional Source Beutler Lab
Gene Symbol Dcaf6
Ensembl Gene ENSMUSG00000026571
Gene NameDDB1 and CUL4 associated factor 6
SynonymsPC326, 1200006M05Rik, Iqwd1
MMRRC Submission 039545-MU
Accession Numbers

Genbank: NM_028759; MGI: 1921356

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1494 (G1)
Quality Score225
Status Validated
Chromosomal Location165328698-165460475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165333373 bp
Amino Acid Change Methionine to Valine at position 828 (M828V)
Ref Sequence ENSEMBL: ENSMUSP00000027856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027856]
Predicted Effect probably damaging
Transcript: ENSMUST00000027856
AA Change: M828V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027856
Gene: ENSMUSG00000026571
AA Change: M828V

WD40 40 79 5.77e-5 SMART
WD40 82 124 1.2e-2 SMART
WD40 130 170 2.15e-1 SMART
WD40 184 220 3.33e-1 SMART
WD40 238 281 6.66e-1 SMART
low complexity region 364 374 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 669 676 N/A INTRINSIC
IQ 691 713 1.25e1 SMART
WD40 722 763 3.84e0 SMART
WD40 766 805 1.22e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193353
Meta Mutation Damage Score 0.1937 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Dcaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Dcaf6 APN 1 165338347 splice site probably benign
IGL01377:Dcaf6 APN 1 165388724 missense probably benign 0.01
IGL02027:Dcaf6 APN 1 165424341 missense probably damaging 1.00
IGL02390:Dcaf6 APN 1 165422921 missense possibly damaging 0.50
IGL02754:Dcaf6 APN 1 165338346 critical splice acceptor site probably null
IGL02900:Dcaf6 APN 1 165399775 missense probably damaging 1.00
IGL03119:Dcaf6 APN 1 165339976 missense probably damaging 1.00
IGL03211:Dcaf6 APN 1 165422933 missense possibly damaging 0.55
R0588:Dcaf6 UTSW 1 165420223 missense possibly damaging 0.89
R1512:Dcaf6 UTSW 1 165352020 missense probably benign 0.22
R1840:Dcaf6 UTSW 1 165399748 missense probably damaging 0.96
R2191:Dcaf6 UTSW 1 165422864 missense probably benign 0.07
R2297:Dcaf6 UTSW 1 165399862 missense probably damaging 1.00
R3082:Dcaf6 UTSW 1 165422852 splice site probably benign
R3861:Dcaf6 UTSW 1 165429269 missense probably damaging 1.00
R3907:Dcaf6 UTSW 1 165424380 nonsense probably null
R4521:Dcaf6 UTSW 1 165390490 missense probably damaging 0.98
R4531:Dcaf6 UTSW 1 165411467 missense probably damaging 1.00
R4906:Dcaf6 UTSW 1 165411463 critical splice donor site probably null
R4916:Dcaf6 UTSW 1 165420205 missense probably damaging 1.00
R4956:Dcaf6 UTSW 1 165388785 missense probably benign 0.00
R5080:Dcaf6 UTSW 1 165420121 missense probably damaging 1.00
R5091:Dcaf6 UTSW 1 165330003 missense possibly damaging 0.76
R5277:Dcaf6 UTSW 1 165424346 missense probably benign 0.09
R5512:Dcaf6 UTSW 1 165399835 missense possibly damaging 0.84
R5914:Dcaf6 UTSW 1 165351155 missense probably benign
R6004:Dcaf6 UTSW 1 165388685 missense probably benign 0.00
R6239:Dcaf6 UTSW 1 165351270 missense possibly damaging 0.47
R6736:Dcaf6 UTSW 1 165399785 missense possibly damaging 0.77
R7051:Dcaf6 UTSW 1 165424317 missense possibly damaging 0.82
R7110:Dcaf6 UTSW 1 165351968 missense probably benign 0.22
R7583:Dcaf6 UTSW 1 165333310 missense probably damaging 1.00
R7776:Dcaf6 UTSW 1 165352054 nonsense probably null
R7790:Dcaf6 UTSW 1 165399715 missense probably damaging 1.00
R8369:Dcaf6 UTSW 1 165357474 missense probably damaging 1.00
R8411:Dcaf6 UTSW 1 165388675 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aaactgctggttttctctcttg -3'
Posted On2014-03-28