Incidental Mutation 'R1494:Gm37240'
ID163802
Institutional Source Beutler Lab
Gene Symbol Gm37240
Ensembl Gene ENSMUSG00000102805
Gene Namepredicted gene, 37240
Synonyms
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1494 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location84496426-85887518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84527691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 104 (Y104N)
Ref Sequence ENSEMBL: ENSMUSP00000096588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098990] [ENSMUST00000107687] [ENSMUST00000143514] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000098990
AA Change: Y104N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096588
Gene: ENSMUSG00000074513
AA Change: Y104N

DomainStartEndE-ValueType
Blast:Arfaptin 1 32 9e-10 BLAST
Arfaptin 89 316 2.08e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107687
AA Change: Y129N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103315
Gene: ENSMUSG00000074513
AA Change: Y129N

DomainStartEndE-ValueType
Blast:Arfaptin 1 32 1e-9 BLAST
Arfaptin 114 341 2.08e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143514
AA Change: Y136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122964
Gene: ENSMUSG00000074513
AA Change: Y136N

DomainStartEndE-ValueType
Blast:Arfaptin 1 32 1e-9 BLAST
Arfaptin 121 348 2.08e-122 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154148
AA Change: Y15N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805
AA Change: Y15N

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.7657 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Gm37240
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1236:Gm37240 UTSW 3 84527696 missense probably benign 0.04
R3746:Gm37240 UTSW 3 84519612 missense probably benign 0.26
R5362:Gm37240 UTSW 3 84515693 missense probably damaging 1.00
R5653:Gm37240 UTSW 3 84497795 missense probably damaging 0.98
R5870:Gm37240 UTSW 3 84690521 intron probably benign
R5913:Gm37240 UTSW 3 84967598 intron probably benign
R6163:Gm37240 UTSW 3 84515785 missense probably damaging 1.00
R7210:Gm37240 UTSW 3 84497807 missense probably benign 0.02
R7378:Gm37240 UTSW 3 84972637 intron probably null
R7769:Gm37240 UTSW 3 84509925 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGAGGGAATGAGTAATGACCTTAGCAGT -3'
(R):5'- CAATCTGTCACACAGTGGGAACCTTTA -3'

Sequencing Primer
(F):5'- cacacacacatacacacacac -3'
(R):5'- CAGTTTGAATAGCATCAGGCTTCG -3'
Posted On2014-03-28