Incidental Mutation 'R1494:Hif3a'
ID163810
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R1494 (G1)
Quality Score110
Status Not validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17054722 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 108 (Y108C)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492] [ENSMUST00000153833]
Predicted Effect probably damaging
Transcript: ENSMUST00000037762
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: Y106C

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108492
AA Change: Y108C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: Y108C

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139224
Predicted Effect silent
Transcript: ENSMUST00000153833
SMART Domains Protein: ENSMUSP00000117728
Gene: ENSMUSG00000004328

DomainStartEndE-ValueType
HLH 20 75 1.27e-7 SMART
low complexity region 87 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206290
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCCTGTCCCAACACACTTTGACC -3'
(R):5'- AAAGCTTAGTGGCCTTGCCCTC -3'

Sequencing Primer
(F):5'- AACACACTTTGACCTTCTGTCTG -3'
(R):5'- GGGACTCCAAGACCCTAGAATTTTC -3'
Posted On2014-03-28