Mutagenetix > Incidental Mutations

Incidental Mutation 'R1494:Dock2'

163825

Institutional Source

Beutler Lab

Gene Symbol

Dock2

Ensembl Gene

ENSMUSG00000020143

Gene Name

dedicator of cyto-kinesis 2

Synonyms

CED-5, MBC, Hch

MMRRC Submission

039545-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1494 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34226815-34783892 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 34282761 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1080 (K1080*)

Ref Sequence

ENSEMBL: ENSMUSP00000098916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093193] [ENSMUST00000101365]

Predicted Effect

probably null
Transcript: ENSMUST00000093193
AA Change: K1080*

SMART Domains

Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: K1080*

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000101365
AA Change: K1080*

SMART Domains

Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: K1080*

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	1.4e-113	PFAM
Pfam:DOCK-C2	419	616	5.5e-61	PFAM
low complexity region	1163	1171	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.3%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	A	G	17: 48,090,471	E92G	probably benign	Het
Abca13	C	T	11: 9,466,429	Q4064*	probably null	Het
Abca14	G	A	7: 120,216,301	M257I	probably benign	Het
Acsm2	T	A	7: 119,575,632	C207S	probably damaging	Het
Actr3	A	G	1: 125,416,281	I67T	probably benign	Het
Adcy7	T	C	8: 88,320,207	V606A	probably benign	Het
Ahnak2	G	A	12: 112,787,950	S54F	probably damaging	Het
Ano6	T	C	15: 95,972,507	S848P	probably damaging	Het
Atg3	C	T	16: 45,171,760		probably benign	Het
Atp8b1	T	A	18: 64,564,526	S416C	probably damaging	Het
C2cd5	A	G	6: 143,041,346		probably benign	Het
Capn11	A	T	17: 45,643,809	V134E	probably damaging	Het
Ccnd3	A	G	17: 47,598,108		probably null	Het
Chaf1b	T	A	16: 93,888,110	V149E	probably damaging	Het
Col5a2	T	A	1: 45,502,914	M1L	unknown	Het
Copa	T	C	1: 172,104,127	I315T	probably benign	Het
Cyp3a57	A	G	5: 145,381,267	M353V	probably damaging	Het
Dcaf6	T	C	1: 165,333,373	M828V	probably damaging	Het
Dock6	A	G	9: 21,814,742	V1424A	probably benign	Het
Foxa1	T	C	12: 57,542,198	D412G	probably damaging	Het
Foxp4	G	C	17: 47,880,353		probably benign	Het
Galnt9	T	A	5: 110,588,330	S171T	probably damaging	Het
Glt6d1	A	G	2: 25,794,248	Y249H	probably damaging	Het
Gm37240	A	T	3: 84,527,691	Y104N	probably damaging	Het
Gpx8	C	T	13: 113,045,615	E95K	possibly damaging	Het
Grm1	T	C	10: 10,689,706	T953A	probably benign	Het
Helz	T	C	11: 107,604,063		probably benign	Het
Hif3a	T	C	7: 17,054,722	Y108C	probably damaging	Het
Kcnj13	A	T	1: 87,389,217	L58Q	probably damaging	Het
Mfsd14b	A	T	13: 65,095,671	V53D	probably damaging	Het
Mrps7	G	C	11: 115,604,126		probably benign	Het
Mug1	G	A	6: 121,879,300	G1013D	probably damaging	Het
Olfr652	T	A	7: 104,564,831	Y203*	probably null	Het
Olfr767	A	T	10: 129,079,615	M116K	probably damaging	Het
Pax6	T	C	2: 105,691,610	I19T	probably benign	Het
Pde8b	G	A	13: 95,047,796	R416C	probably damaging	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
Pygl	G	A	12: 70,199,730	R348W	probably damaging	Het
Ralgapa1	T	A	12: 55,684,524	D1874V	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Sncaip	T	C	18: 52,868,886	S160P	probably damaging	Het
Sptbn4	A	G	7: 27,434,294	V79A	probably damaging	Het
Sptlc3	A	T	2: 139,589,560	Y334F	possibly damaging	Het
Supt16	A	G	14: 52,172,459	Y764H	probably benign	Het
Syne3	A	T	12: 104,955,582	V438E	possibly damaging	Het
Tagap1	T	C	17: 6,956,811	D162G	probably damaging	Het
Terb1	T	C	8: 104,498,490		probably benign	Het
Themis3	C	A	17: 66,559,954	R97L	probably benign	Het
Tnk1	T	A	11: 69,856,546	E86D	possibly damaging	Het
Tnpo3	A	G	6: 29,557,044	L53P	probably damaging	Het
Trpc6	G	A	9: 8,658,304	R725K	probably benign	Het
Ttll11	T	G	2: 35,795,379	T566P	probably damaging	Het
Unc5c	A	T	3: 141,827,549	T779S	possibly damaging	Het
Zfp42	A	G	8: 43,295,601	C288R	possibly damaging	Het
Zfp763	G	A	17: 33,021,503	T52I	probably damaging	Het

Other mutations in Dock2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Dock2	APN	11	34704661	missense	probably damaging	1.00
IGL00469:Dock2	APN	11	34229603	splice site	probably benign
IGL01061:Dock2	APN	11	34705826	missense	probably damaging	1.00
IGL01319:Dock2	APN	11	34698790	missense	possibly damaging	0.61
IGL01451:Dock2	APN	11	34310390	missense	probably damaging	1.00
IGL01490:Dock2	APN	11	34705781	missense	probably damaging	0.97
IGL01601:Dock2	APN	11	34239528	critical splice donor site	probably null
IGL01800:Dock2	APN	11	34756273	missense	probably damaging	1.00
IGL01804:Dock2	APN	11	34262433	missense	probably benign	0.01
IGL01823:Dock2	APN	11	34262391	missense	probably damaging	1.00
IGL01829:Dock2	APN	11	34705841	missense	probably damaging	0.98
IGL01830:Dock2	APN	11	34691917	nonsense	probably null
IGL01835:Dock2	APN	11	34310435	missense	possibly damaging	0.51
IGL01845:Dock2	APN	11	34708865	missense	probably benign	0.02
IGL01953:Dock2	APN	11	34732356	missense	probably benign	0.28
IGL01989:Dock2	APN	11	34268053	missense	probably benign
IGL02081:Dock2	APN	11	34254355	missense	probably benign
IGL02105:Dock2	APN	11	34714525	missense	probably damaging	1.00
IGL02153:Dock2	APN	11	34230670	missense	probably benign	0.01
IGL02170:Dock2	APN	11	34267949	missense	probably damaging	1.00
IGL02344:Dock2	APN	11	34731510	missense	probably damaging	0.98
IGL02389:Dock2	APN	11	34698740	splice site	probably benign
IGL02409:Dock2	APN	11	34501204	missense	probably benign	0.00
IGL02472:Dock2	APN	11	34249801	missense	probably benign	0.00
IGL02625:Dock2	APN	11	34501168	critical splice donor site	probably null
IGL02929:Dock2	APN	11	34268048	missense	probably damaging	1.00
IGL02951:Dock2	APN	11	34310448	unclassified	probably benign
IGL02999:Dock2	APN	11	34692259	missense	probably damaging	0.99
IGL03165:Dock2	APN	11	34687533	missense	probably damaging	0.99
Arches	UTSW	11	34689760	missense	probably damaging	1.00
capitol_reef	UTSW	11	34294170	critical splice acceptor site	probably null
Croesus	UTSW	11	34721027	missense	probably damaging	1.00
denali	UTSW	11	34229472	critical splice donor site	probably null
dew	UTSW	11	34248636	nonsense	probably null
Dry	UTSW	11	34231652	missense	possibly damaging	0.79
frazz	UTSW	11	34248572	critical splice donor site	probably benign
frizz	UTSW	11	34258184	splice site	probably benign
gildenstern	UTSW	11	34732339	critical splice donor site	probably null
godsgrace	UTSW	11	34695453	missense	probably damaging	1.00
Harborside	UTSW	11	34262445	missense	probably benign
Landing	UTSW	11	34714501	missense	possibly damaging	0.83
latest	UTSW	11	34756222	missense	probably damaging	1.00
Launch	UTSW	11	34256562	missense	probably damaging	1.00
liaoning	UTSW	11	34708793	missense	probably damaging	1.00
midas	UTSW	11	34294323	missense	probably damaging	0.99
muelle	UTSW	11	34687538	missense	probably damaging	1.00
narrowest	UTSW	11	34282652	missense	probably damaging	0.98
pier	UTSW	11	34689766	missense	probably damaging	1.00
Plank	UTSW	11	34783795	missense	possibly damaging	0.51
riches	UTSW	11	34688452	critical splice donor site	probably null
skiff	UTSW	11	34262388	missense	probably null	0.80
Slip	UTSW	11	34294286	missense	probably benign	0.25
toothskin	UTSW	11	34464922	missense	probably damaging	1.00
Touch	UTSW	11	34273750	missense	possibly damaging	0.95
wassup	UTSW	11	34503413	missense	probably damaging	1.00
Wharf	UTSW	11	34732371	missense	possibly damaging	0.81
BB009:Dock2	UTSW	11	34267998	missense	probably benign	0.00
BB019:Dock2	UTSW	11	34267998	missense	probably benign	0.00
IGL03052:Dock2	UTSW	11	34232853	missense	probably benign	0.01
PIT4377001:Dock2	UTSW	11	34721008	missense	probably benign	0.02
R0006:Dock2	UTSW	11	34312453	unclassified	probably benign
R0012:Dock2	UTSW	11	34783795	missense	possibly damaging	0.51
R0063:Dock2	UTSW	11	34756284	critical splice acceptor site	probably null
R0063:Dock2	UTSW	11	34756284	critical splice acceptor site	probably null
R0116:Dock2	UTSW	11	34688565	intron	probably benign
R0149:Dock2	UTSW	11	34438327	missense	probably damaging	1.00
R0361:Dock2	UTSW	11	34438327	missense	probably damaging	1.00
R0462:Dock2	UTSW	11	34268052	missense	possibly damaging	0.74
R0471:Dock2	UTSW	11	34688553	missense	probably benign	0.30
R0538:Dock2	UTSW	11	34704718	splice site	probably benign
R0543:Dock2	UTSW	11	34294325	missense	probably damaging	1.00
R0660:Dock2	UTSW	11	34248621	missense	probably damaging	1.00
R0676:Dock2	UTSW	11	34695236	missense	probably damaging	0.99
R0722:Dock2	UTSW	11	34464970	splice site	probably benign
R0801:Dock2	UTSW	11	34708793	missense	probably damaging	1.00
R1110:Dock2	UTSW	11	34256535	missense	possibly damaging	0.78
R1171:Dock2	UTSW	11	34695241	missense	probably damaging	1.00
R1387:Dock2	UTSW	11	34273309	splice site	probably benign
R1445:Dock2	UTSW	11	34239705	missense	probably benign
R1589:Dock2	UTSW	11	34706461	missense	probably damaging	0.99
R1597:Dock2	UTSW	11	34704647	missense	probably benign	0.00
R1629:Dock2	UTSW	11	34262480	splice site	probably null
R1749:Dock2	UTSW	11	34232767	critical splice donor site	probably null
R1888:Dock2	UTSW	11	34707342	missense	probably damaging	1.00
R1888:Dock2	UTSW	11	34707342	missense	probably damaging	1.00
R1899:Dock2	UTSW	11	34294286	missense	probably benign	0.25
R1924:Dock2	UTSW	11	34464934	missense	possibly damaging	0.69
R2031:Dock2	UTSW	11	34727470	splice site	probably benign
R2045:Dock2	UTSW	11	34294106	splice site	probably null
R2098:Dock2	UTSW	11	34266279	missense	probably benign	0.16
R2098:Dock2	UTSW	11	34719005	missense	probably damaging	0.99
R2129:Dock2	UTSW	11	34727415	missense	probably damaging	1.00
R2147:Dock2	UTSW	11	34229472	critical splice donor site	probably null
R2149:Dock2	UTSW	11	34229472	critical splice donor site	probably null
R2150:Dock2	UTSW	11	34229472	critical splice donor site	probably null
R2176:Dock2	UTSW	11	34695217	missense	probably benign	0.00
R2230:Dock2	UTSW	11	34294323	missense	probably damaging	0.99
R2508:Dock2	UTSW	11	34312485	missense	probably benign	0.04
R2875:Dock2	UTSW	11	34718885	missense	probably damaging	1.00
R2885:Dock2	UTSW	11	34689766	missense	probably damaging	1.00
R2910:Dock2	UTSW	11	34232910	splice site	probably benign
R3081:Dock2	UTSW	11	34231610	missense	probably benign
R3418:Dock2	UTSW	11	34689760	missense	probably damaging	1.00
R3552:Dock2	UTSW	11	34720960	missense	probably benign	0.22
R3731:Dock2	UTSW	11	34708895	missense	probably damaging	1.00
R3846:Dock2	UTSW	11	34732371	missense	possibly damaging	0.81
R4135:Dock2	UTSW	11	34714501	missense	possibly damaging	0.83
R4598:Dock2	UTSW	11	34239536	missense	probably damaging	1.00
R4599:Dock2	UTSW	11	34239536	missense	probably damaging	1.00
R4715:Dock2	UTSW	11	34294118	missense	probably damaging	1.00
R4722:Dock2	UTSW	11	34695471	missense	probably damaging	1.00
R4742:Dock2	UTSW	11	34294170	critical splice acceptor site	probably null
R4830:Dock2	UTSW	11	34273767	splice site	probably null
R4884:Dock2	UTSW	11	34266248	missense	probably damaging	1.00
R4990:Dock2	UTSW	11	34695251	missense	probably damaging	1.00
R5334:Dock2	UTSW	11	34228643	missense	probably benign	0.00
R5570:Dock2	UTSW	11	34727406	missense	probably damaging	1.00
R5602:Dock2	UTSW	11	34254391	missense	probably benign	0.16
R5681:Dock2	UTSW	11	34249836	missense	probably benign	0.06
R5809:Dock2	UTSW	11	34262445	missense	probably benign
R5860:Dock2	UTSW	11	34256562	missense	probably damaging	1.00
R6111:Dock2	UTSW	11	34708787	missense	probably damaging	0.99
R6155:Dock2	UTSW	11	34294123	missense	probably benign	0.06
R6156:Dock2	UTSW	11	34247789	missense	possibly damaging	0.51
R6173:Dock2	UTSW	11	34262388	missense	probably null	0.80
R6182:Dock2	UTSW	11	34229476	missense	probably damaging	0.97
R6188:Dock2	UTSW	11	34503396	missense	probably damaging	0.98
R6191:Dock2	UTSW	11	34231652	missense	possibly damaging	0.79
R6283:Dock2	UTSW	11	34707325	missense	probably damaging	0.99
R6395:Dock2	UTSW	11	34232874	missense	probably damaging	1.00
R6465:Dock2	UTSW	11	34503413	missense	probably damaging	1.00
R6500:Dock2	UTSW	11	34362822	missense	possibly damaging	0.76
R6561:Dock2	UTSW	11	34687538	missense	probably damaging	1.00
R6745:Dock2	UTSW	11	34705842	missense	probably damaging	1.00
R6745:Dock2	UTSW	11	34705843	missense	probably damaging	1.00
R6880:Dock2	UTSW	11	34688452	critical splice donor site	probably null
R6913:Dock2	UTSW	11	34756222	missense	probably damaging	1.00
R6997:Dock2	UTSW	11	34464922	missense	probably damaging	1.00
R7057:Dock2	UTSW	11	34227684	missense	probably benign	0.10
R7057:Dock2	UTSW	11	34695217	missense	probably benign	0.00
R7134:Dock2	UTSW	11	34310363	missense	probably benign	0.03
R7188:Dock2	UTSW	11	34239675	missense	possibly damaging	0.87
R7239:Dock2	UTSW	11	34231677	missense	probably benign	0.00
R7247:Dock2	UTSW	11	34714513	nonsense	probably null
R7250:Dock2	UTSW	11	34695205	missense	probably benign	0.01
R7250:Dock2	UTSW	11	34695293	missense	probably damaging	1.00
R7271:Dock2	UTSW	11	34273750	missense	possibly damaging	0.95
R7284:Dock2	UTSW	11	34230672	missense	probably benign	0.01
R7397:Dock2	UTSW	11	34718989	missense	probably benign	0.00
R7464:Dock2	UTSW	11	34695278	missense	probably damaging	0.99
R7512:Dock2	UTSW	11	34312542	missense	possibly damaging	0.95
R7556:Dock2	UTSW	11	34720951	missense	probably benign	0.43
R7663:Dock2	UTSW	11	34721027	missense	probably damaging	1.00
R7779:Dock2	UTSW	11	34714455	missense	probably benign	0.38
R7797:Dock2	UTSW	11	34282652	missense	probably damaging	0.98
R7855:Dock2	UTSW	11	34273698	missense	probably damaging	1.00
R7922:Dock2	UTSW	11	34707327	missense	probably benign	0.29
R7932:Dock2	UTSW	11	34267998	missense	probably benign	0.00
R8013:Dock2	UTSW	11	34705850	missense	probably damaging	0.96
R8192:Dock2	UTSW	11	34732339	critical splice donor site	probably null
R8244:Dock2	UTSW	11	34695453	missense	probably damaging	1.00
R8307:Dock2	UTSW	11	34310362	missense	possibly damaging	0.95
R8418:Dock2	UTSW	11	34718968	missense	probably benign	0.01
R8460:Dock2	UTSW	11	34230825	critical splice acceptor site	probably null
R8495:Dock2	UTSW	11	34231622	missense	probably benign	0.14
R8556:Dock2	UTSW	11	34262457	missense	possibly damaging	0.84
X0017:Dock2	UTSW	11	34266271	missense	probably benign	0.08
X0018:Dock2	UTSW	11	34232833	missense	possibly damaging	0.65
X0058:Dock2	UTSW	11	34256564	missense	probably damaging	1.00
X0066:Dock2	UTSW	11	34310357	missense	possibly damaging	0.95
Z1088:Dock2	UTSW	11	34438300	missense	probably benign	0.14
Z1088:Dock2	UTSW	11	34692382	missense	probably damaging	1.00
Z1088:Dock2	UTSW	11	34695212	nonsense	probably null
Z1176:Dock2	UTSW	11	34718924	missense	probably benign	0.04
Z1177:Dock2	UTSW	11	34312553	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TAATGTCCCTATCCCGCAGAAGCC -3'
(R):5'- GATCCATGCTCATCCCTCAGCAAG -3'

Sequencing Primer
(F):5'- TCTCAGTGAAGCACAGGC -3'
(R):5'- GCTAACCTATACATAATGATCAGAGC -3'

Posted On

2014-03-28