Incidental Mutation 'R1494:Foxa1'
ID163830
Institutional Source Beutler Lab
Gene Symbol Foxa1
Ensembl Gene ENSMUSG00000035451
Gene Nameforkhead box A1
SynonymsHnf3a, Hnf-3a, Tcf3a, Tcf-3a
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1494 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location57540628-57546916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57542198 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 412 (D412G)
Ref Sequence ENSEMBL: ENSMUSP00000041118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044380]
Predicted Effect probably damaging
Transcript: ENSMUST00000044380
AA Change: D412G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041118
Gene: ENSMUSG00000035451
AA Change: D412G

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
FH 168 258 3.88e-62 SMART
low complexity region 273 286 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
Pfam:HNF_C 393 457 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218398
Meta Mutation Damage Score 0.6515 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal feeding, hypoglycemia, impaired glucagon secretion, hypotryglyceridemia, wasting, and lethality between postnatal days 2 and 14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Foxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Foxa1 APN 12 57542657 missense probably damaging 1.00
IGL02371:Foxa1 APN 12 57542700 missense probably damaging 0.98
IGL03150:Foxa1 APN 12 57542296 missense probably benign 0.41
PIT4377001:Foxa1 UTSW 12 57542781 missense probably damaging 1.00
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1598:Foxa1 UTSW 12 57542687 missense possibly damaging 0.69
R1809:Foxa1 UTSW 12 57542741 missense probably damaging 1.00
R5554:Foxa1 UTSW 12 57542291 missense probably benign 0.00
R5667:Foxa1 UTSW 12 57542295 missense probably benign 0.01
R5782:Foxa1 UTSW 12 57542516 missense probably benign 0.00
R6174:Foxa1 UTSW 12 57542900 missense probably damaging 1.00
R6750:Foxa1 UTSW 12 57542610 missense probably benign 0.32
R6781:Foxa1 UTSW 12 57543257 missense possibly damaging 0.74
R6995:Foxa1 UTSW 12 57542478 missense probably benign 0.00
R7209:Foxa1 UTSW 12 57543291 missense probably benign 0.03
R7864:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
R7947:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
X0020:Foxa1 UTSW 12 57543312 missense possibly damaging 0.73
Z1177:Foxa1 UTSW 12 57542417 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGGAACTAGAATGTGTCCGCAG -3'
(R):5'- TTCGGAGTTGAAGTCTCCAGCGTC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtctgtgtg -3'
(R):5'- GAAGTCTCCAGCGTCTTCATC -3'
Posted On2014-03-28