Incidental Mutation 'R1494:Ano6'
ID163840
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R1494 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95972507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 848 (S848P)
Ref Sequence ENSEMBL: ENSMUSP00000071770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: S848P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: S848P

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227616
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: S869P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.4961 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCCTCGCTCATGCTAAAGGAAC -3'
(R):5'- AGTGCTTCACACACGTCTGACAG -3'

Sequencing Primer
(F):5'- CCGTTGCTTTGAGACTGAAG -3'
(R):5'- TCGAGTTTTGGCCGCAC -3'
Posted On2014-03-28