Incidental Mutation 'R1474:Astn1'
ID163858
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Nameastrotactin 1
Synonyms
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1474 (G1)
Quality Score222
Status Validated
Chromosome1
Chromosomal Location158362273-158691781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158502353 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 259 (N259K)
Ref Sequence ENSEMBL: ENSMUSP00000141518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]
Predicted Effect probably damaging
Transcript: ENSMUST00000046110
AA Change: N259K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: N259K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093595
Predicted Effect possibly damaging
Transcript: ENSMUST00000170718
AA Change: N259K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: N259K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192868
Predicted Effect probably damaging
Transcript: ENSMUST00000193042
AA Change: N259K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: N259K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194369
AA Change: N259K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: N259K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000195311
AA Change: N259K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: N259K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158600319 missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158504313 missense probably damaging 1.00
IGL01790:Astn1 APN 1 158580327 missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158668631 missense probably damaging 1.00
IGL02000:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02119:Astn1 APN 1 158511154 intron probably benign
IGL02168:Astn1 APN 1 158609341 missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158664130 critical splice donor site probably null
IGL02271:Astn1 APN 1 158510950 splice site probably benign
IGL02307:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02504:Astn1 APN 1 158502408 missense probably damaging 1.00
IGL02552:Astn1 APN 1 158505395 missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158688550 missense probably damaging 0.99
IGL03003:Astn1 APN 1 158612395 missense probably benign 0.00
IGL03007:Astn1 APN 1 158668623 splice site probably benign
IGL03354:Astn1 APN 1 158688604 missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158597209 missense probably benign 0.20
PIT4366001:Astn1 UTSW 1 158597211 missense probably benign 0.23
R0024:Astn1 UTSW 1 158684215 missense probably damaging 0.99
R0050:Astn1 UTSW 1 158579724 splice site probably benign
R0099:Astn1 UTSW 1 158502151 missense probably damaging 1.00
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158688548 missense probably damaging 1.00
R0416:Astn1 UTSW 1 158509891 missense probably damaging 1.00
R0531:Astn1 UTSW 1 158600389 missense probably damaging 0.99
R0735:Astn1 UTSW 1 158472389 missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158509890 missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158511109 nonsense probably null
R1027:Astn1 UTSW 1 158580279 missense probably damaging 1.00
R1160:Astn1 UTSW 1 158600365 missense possibly damaging 0.83
R1517:Astn1 UTSW 1 158579576 splice site probably benign
R1701:Astn1 UTSW 1 158504307 missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158504251 missense probably benign 0.35
R1860:Astn1 UTSW 1 158601945 missense probably damaging 1.00
R1889:Astn1 UTSW 1 158505316 intron probably null
R1919:Astn1 UTSW 1 158509971 missense probably damaging 1.00
R2001:Astn1 UTSW 1 158520521 missense probably damaging 1.00
R2007:Astn1 UTSW 1 158609305 missense probably damaging 0.97
R2038:Astn1 UTSW 1 158657120 missense probably benign 0.29
R2044:Astn1 UTSW 1 158600502 missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158472408 missense probably damaging 0.99
R2094:Astn1 UTSW 1 158667609 missense probably benign 0.02
R2163:Astn1 UTSW 1 158502150 missense probably damaging 0.99
R2211:Astn1 UTSW 1 158657306 missense probably benign 0.40
R2268:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2269:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2425:Astn1 UTSW 1 158579666 missense probably damaging 0.99
R2428:Astn1 UTSW 1 158612346 missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158572951 critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158667532 missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158502060 missense probably damaging 1.00
R3926:Astn1 UTSW 1 158579657 missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158502032 intron probably null
R4625:Astn1 UTSW 1 158580294 missense probably damaging 1.00
R4627:Astn1 UTSW 1 158502251 missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158612532 missense probably damaging 1.00
R5292:Astn1 UTSW 1 158580363 critical splice donor site probably null
R5889:Astn1 UTSW 1 158600380 missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158601937 missense probably damaging 1.00
R6020:Astn1 UTSW 1 158509993 missense probably damaging 1.00
R6349:Astn1 UTSW 1 158664121 nonsense probably null
R6481:Astn1 UTSW 1 158612462 missense probably benign 0.29
R6736:Astn1 UTSW 1 158511148 critical splice donor site probably null
R6833:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6834:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6860:Astn1 UTSW 1 158612472 missense probably damaging 1.00
R6874:Astn1 UTSW 1 158664074 nonsense probably null
R7062:Astn1 UTSW 1 158688511 critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158572987 missense probably damaging 1.00
R7355:Astn1 UTSW 1 158664276 intron probably null
R7402:Astn1 UTSW 1 158552855 intron probably benign
R7412:Astn1 UTSW 1 158502349 missense probably damaging 0.98
R7487:Astn1 UTSW 1 158610782 intron probably null
R7537:Astn1 UTSW 1 158505386 missense possibly damaging 0.84
R7537:Astn1 UTSW 1 158667638 splice site probably null
R7635:Astn1 UTSW 1 158667535 nonsense probably null
R7890:Astn1 UTSW 1 158580333 missense probably damaging 1.00
R7894:Astn1 UTSW 1 158601938 missense probably damaging 0.98
R7904:Astn1 UTSW 1 158597316 missense probably benign 0.37
R7973:Astn1 UTSW 1 158580333 missense probably damaging 1.00
R7977:Astn1 UTSW 1 158601938 missense probably damaging 0.98
R7987:Astn1 UTSW 1 158597316 missense probably benign 0.37
R8048:Astn1 UTSW 1 158688638
R8061:Astn1 UTSW 1 158504350
Z1088:Astn1 UTSW 1 158472497 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158597206 missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158684096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGGTGATGATCCTGTACACTC -3'
(R):5'- TTACGCTTTGGCTCCCTGAGCAAG -3'

Sequencing Primer
(F):5'- ATGAGATTCACTACATCCCATCTGTG -3'
(R):5'- TCCCTGAGCAAGGACTAAACAG -3'
Posted On2014-03-28