Mutagenetix > Incidental Mutation

Incidental Mutation 'R1474:Celsr2'

163874

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

039527-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1474 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108393739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2746 (E2746G)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090558
AA Change: E2746G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: E2746G

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130941

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133216

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147251
AA Change: E734G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: E734G

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Meta Mutation Damage Score

0.0605

Coding Region Coverage

1x: 99.3%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

95% (104/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	C	A	7: 139,976,642	R144L	probably benign	Het
9030624J02Rik	T	C	7: 118,760,213	F230S	probably damaging	Het
Abca8a	C	A	11: 110,069,809	A628S	probably damaging	Het
Abca9	T	C	11: 110,145,579	N568S	probably damaging	Het
Ada	C	T	2: 163,732,894	A108T	possibly damaging	Het
Adam6a	T	A	12: 113,544,449	D147E	possibly damaging	Het
Ampd1	A	T	3: 103,098,838	T655S	probably damaging	Het
Ankk1	A	G	9: 49,415,839	F680S	probably damaging	Het
Asap1	G	A	15: 64,120,020	T783I	probably benign	Het
Astn1	T	A	1: 158,502,353	N259K	probably damaging	Het
Birc6	T	C	17: 74,579,678	V667A	probably damaging	Het
Brat1	G	A	5: 140,712,627	V185I	probably benign	Het
Btnl6	T	C	17: 34,513,646	Y318C	probably damaging	Het
Caskin2	G	A	11: 115,803,696	P360S	probably benign	Het
Cd68	T	A	11: 69,664,928		probably benign	Het
Cdca2	T	C	14: 67,714,906		probably benign	Het
Cdk6	G	A	5: 3,473,217	M212I	probably benign	Het
Ceacam5	T	A	7: 17,747,234	F302Y	probably damaging	Het
Clec4a4	G	A	6: 123,012,744	V115I	probably benign	Het
Clip3	C	A	7: 30,298,882	A251E	possibly damaging	Het
Cmah	T	C	13: 24,439,197	L350P	probably damaging	Het
Cntnap5a	C	T	1: 116,442,373	R907*	probably null	Het
Cntnap5b	T	C	1: 100,072,089	Y191H	probably benign	Het
Col4a4	A	T	1: 82,480,486	C1122*	probably null	Het
Coq5	A	G	5: 115,295,783		probably benign	Het
Cpxcr1	A	G	X: 116,477,439	K16E	possibly damaging	Het
Dclk3	T	C	9: 111,469,236	I616T	probably benign	Het
Ddx58	A	G	4: 40,208,868	V703A	possibly damaging	Het
Dhrs3	A	T	4: 144,919,487	T122S	probably damaging	Het
Dnm1	T	C	2: 32,320,584	I502V	probably benign	Het
Dscaml1	G	T	9: 45,685,221	G788W	probably damaging	Het
Dusp10	C	T	1: 184,037,448		probably null	Het
Ehbp1l1	C	A	19: 5,719,084	L730F	possibly damaging	Het
Eif2ak1	C	T	5: 143,871,967	H75Y	probably damaging	Het
Evi2a	T	C	11: 79,527,572	T71A	probably benign	Het
Fam184a	A	T	10: 53,635,365	S1073T	probably damaging	Het
Fam227a	T	C	15: 79,615,381	Y591C	probably damaging	Het
Fam83a	C	T	15: 58,009,876	T367M	probably benign	Het
Fam83g	A	G	11: 61,702,993	D451G	probably damaging	Het
Fbn1	A	G	2: 125,361,265	F1213L	possibly damaging	Het
Fcgbp	G	A	7: 28,091,848	V845I	probably benign	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Foxn1	T	A	11: 78,361,107	M433L	probably benign	Het
Gm6583	T	C	5: 112,355,776	T21A	probably benign	Het
Gm6632	T	G	5: 59,054,336		noncoding transcript	Het
Gnl3	A	T	14: 31,016,461		probably benign	Het
Hhipl1	C	T	12: 108,311,737	T108I	probably damaging	Het
Hs2st1	A	T	3: 144,435,495	F271I	possibly damaging	Het
Ido1	T	C	8: 24,584,446	S303G	probably damaging	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Kcnc2	A	G	10: 112,456,400	K49E	probably damaging	Het
Kif3b	T	A	2: 153,320,315	V482E	probably damaging	Het
Ldlrad2	G	A	4: 137,572,214	P100S	probably benign	Het
Lrba	G	T	3: 86,780,266		probably benign	Het
Lsm11	A	T	11: 45,933,903	W266R	probably benign	Het
Mob3a	A	T	10: 80,687,154	M215K	probably benign	Het
Mterf1b	T	G	5: 4,197,163	L268R	probably damaging	Het
Mvk	T	C	5: 114,460,096	F365L	probably damaging	Het
Myo16	T	A	8: 10,502,796	F945I	probably damaging	Het
Myo1f	G	T	17: 33,594,027	K602N	possibly damaging	Het
Nr2c2ap	A	T	8: 70,133,115	M108L	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Ogfrl1	A	G	1: 23,375,809	F206L	probably damaging	Het
Ola1	A	T	2: 73,156,844	I148N	probably damaging	Het
Olfr1158	A	G	2: 87,990,990	N293S	probably damaging	Het
Olfr1424	T	A	19: 12,059,480	T91S	probably benign	Het
Olfr310	G	T	7: 86,269,062	H242Q	probably damaging	Het
Olfr583	A	G	7: 103,052,081	Y261C	probably damaging	Het
Olfr791	A	T	10: 129,526,955	M243L	probably benign	Het
Otof	A	G	5: 30,379,532		probably null	Het
Pah	G	T	10: 87,578,313	K341N	probably damaging	Het
Pfdn5	T	A	15: 102,328,511		probably null	Het
Piezo2	A	G	18: 63,083,131	C960R	probably damaging	Het
Pitx2	T	C	3: 129,218,839	V306A	probably damaging	Het
Pkd1l2	C	A	8: 117,065,497		probably benign	Het
Plekho1	T	C	3: 95,989,566	E197G	probably damaging	Het
Polr2i	A	G	7: 30,232,802	N34S	probably damaging	Het
Psph	A	T	5: 129,771,550	D22E	probably damaging	Het
Ptprs	C	A	17: 56,424,128	A687S	probably damaging	Het
Ralgapa1	T	C	12: 55,741,480	K606R	probably benign	Het
Rims1	A	G	1: 22,538,281		probably benign	Het
Rnf213	C	T	11: 119,437,750	P2002L	probably damaging	Het
Ryr3	A	T	2: 112,909,962	C555S	probably damaging	Het
Sftpd	C	A	14: 41,172,427	G345V	probably damaging	Het
Slc41a1	T	A	1: 131,846,581	M462K	probably damaging	Het
Slc44a2	A	G	9: 21,353,694	E676G	probably damaging	Het
Sox6	T	A	7: 115,701,691		probably benign	Het
Spdye4b	G	A	5: 143,195,717	R109Q	probably damaging	Het
Spink8	A	T	9: 109,820,638	I63L	probably damaging	Het
St3gal3	A	G	4: 118,014,786	L73P	probably damaging	Het
Stab1	A	G	14: 31,149,861	L1247P	probably benign	Het
Tat	A	G	8: 109,991,563	R27G	probably benign	Het
Tcerg1l	C	T	7: 138,280,075	R295H	probably damaging	Het
Tfrc	T	C	16: 32,626,649	V596A	probably damaging	Het
Tgfb3	C	T	12: 86,069,346		probably null	Het
Tmed5	A	T	5: 108,132,382	S15T	probably benign	Het
Tph1	A	T	7: 46,653,862	S231T	probably benign	Het
Trim30d	G	A	7: 104,472,494	S198L	probably damaging	Het
Trpm6	T	C	19: 18,796,495	M412T	probably benign	Het
Ttn	G	T	2: 76,782,245	D15417E	probably benign	Het
U2surp	A	G	9: 95,493,198	I157T	possibly damaging	Het
Ubr4	A	G	4: 139,429,579	D2305G	probably damaging	Het
Uvssa	A	G	5: 33,388,821	K179E	probably benign	Het
Xirp2	A	G	2: 67,525,067	K3391E	probably benign	Het
Xpo7	T	A	14: 70,699,033	H170L	probably benign	Het
Zrsr1	T	C	11: 22,974,404	W393R	probably benign	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GCAGACAGTTAGGATAGCCACCAC -3'
(R):5'- TTTAGGGAGGAGTCCACGCTGAAC -3'

Sequencing Primer
(F):5'- CCCCAGCTCTATTTTCCAAAAAG -3'
(R):5'- CTGTTCTTGGAAGGCCAAGC -3'

Posted On

2014-03-28