Incidental Mutation 'R1474:Celsr2'
ID163874
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission 039527-MU
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1474 (G1)
Quality Score199
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108393739 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2746 (E2746G)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090558
AA Change: E2746G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: E2746G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133216
Predicted Effect possibly damaging
Transcript: ENSMUST00000147251
AA Change: E734G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: E734G

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
barrow UTSW 3 108394965 missense possibly damaging 0.92
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
R7062:Celsr2 UTSW 3 108402510 missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108397865 missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108415359 missense unknown
R7326:Celsr2 UTSW 3 108394995 missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108402457 missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108413090 missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R7613:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108413490 missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108398588 missense probably benign
R7687:Celsr2 UTSW 3 108397769 missense probably benign 0.27
R7695:Celsr2 UTSW 3 108402753 missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACAGTTAGGATAGCCACCAC -3'
(R):5'- TTTAGGGAGGAGTCCACGCTGAAC -3'

Sequencing Primer
(F):5'- CCCCAGCTCTATTTTCCAAAAAG -3'
(R):5'- CTGTTCTTGGAAGGCCAAGC -3'
Posted On2014-03-28