Incidental Mutation 'R1474:Clec4a4'
Institutional Source Beutler Lab
Gene Symbol Clec4a4
Ensembl Gene ENSMUSG00000059639
Gene NameC-type lectin domain family 4, member a4
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1474 (G1)
Quality Score225
Status Validated
Chromosomal Location122990367-123024105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123012744 bp
Amino Acid Change Valine to Isoleucine at position 115 (V115I)
Ref Sequence ENSEMBL: ENSMUSP00000078351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079379]
PDB Structure
Crystal structure of C-type lectin domain of murine dendritic cell inhibitory receptor 2 (apo form) [X-RAY DIFFRACTION]
Crystal structure of C-type lectin domain of murine dendritic cell inhibitory receptor 2 in complex with N-glycan [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079379
AA Change: V115I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078351
Gene: ENSMUSG00000059639
AA Change: V115I

transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 230 1.72e-32 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Clec4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Clec4a4 APN 6 123024016 nonsense probably null
IGL01659:Clec4a4 APN 6 123023935 missense probably damaging 0.98
IGL02455:Clec4a4 APN 6 123013780 missense possibly damaging 0.94
IGL02726:Clec4a4 APN 6 122990379 missense probably damaging 0.99
IGL03241:Clec4a4 APN 6 122990373 missense probably damaging 0.99
R0751:Clec4a4 UTSW 6 123012712 missense probably benign 0.12
R1184:Clec4a4 UTSW 6 123012712 missense probably benign 0.12
R1455:Clec4a4 UTSW 6 123012799 missense possibly damaging 0.60
R1514:Clec4a4 UTSW 6 122990442 missense probably benign 0.26
R1779:Clec4a4 UTSW 6 123023975 missense probably damaging 1.00
R2138:Clec4a4 UTSW 6 123023978 missense probably damaging 0.99
R2182:Clec4a4 UTSW 6 123013757 critical splice acceptor site probably null
R2207:Clec4a4 UTSW 6 123013807 missense probably damaging 1.00
R3817:Clec4a4 UTSW 6 122990407 missense probably damaging 0.99
R5474:Clec4a4 UTSW 6 123012747 missense probably damaging 0.99
R5917:Clec4a4 UTSW 6 123004058 missense probably benign 0.25
R6164:Clec4a4 UTSW 6 122991874 missense possibly damaging 0.89
R6628:Clec4a4 UTSW 6 123012804 missense probably benign 0.23
R7212:Clec4a4 UTSW 6 122991745 splice site probably null
R7399:Clec4a4 UTSW 6 122991829 missense possibly damaging 0.86
R7808:Clec4a4 UTSW 6 122990380 missense probably damaging 0.96
X0013:Clec4a4 UTSW 6 123023912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- tgcagggttcatttgataAAAGCATACCAt -3'

Sequencing Primer
(F):5'- ccagattgttgtgtgttatgtcc -3'
Posted On2014-03-28