Mutagenetix > Incidental Mutation

Incidental Mutation 'R1474:Ints2'

163940

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

039527-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1474 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86226781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 705 (R705H)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: R705H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: R705H

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: R705H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: R705H

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000134828
AA Change: R18H

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146421

Meta Mutation Damage Score

0.3766

Coding Region Coverage

1x: 99.3%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

95% (104/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	C	A	7: 139,976,642	R144L	probably benign	Het
9030624J02Rik	T	C	7: 118,760,213	F230S	probably damaging	Het
Abca8a	C	A	11: 110,069,809	A628S	probably damaging	Het
Abca9	T	C	11: 110,145,579	N568S	probably damaging	Het
Ada	C	T	2: 163,732,894	A108T	possibly damaging	Het
Adam6a	T	A	12: 113,544,449	D147E	possibly damaging	Het
Ampd1	A	T	3: 103,098,838	T655S	probably damaging	Het
Ankk1	A	G	9: 49,415,839	F680S	probably damaging	Het
Asap1	G	A	15: 64,120,020	T783I	probably benign	Het
Astn1	T	A	1: 158,502,353	N259K	probably damaging	Het
Birc6	T	C	17: 74,579,678	V667A	probably damaging	Het
Brat1	G	A	5: 140,712,627	V185I	probably benign	Het
Btnl6	T	C	17: 34,513,646	Y318C	probably damaging	Het
Caskin2	G	A	11: 115,803,696	P360S	probably benign	Het
Cd68	T	A	11: 69,664,928		probably benign	Het
Cdca2	T	C	14: 67,714,906		probably benign	Het
Cdk6	G	A	5: 3,473,217	M212I	probably benign	Het
Ceacam5	T	A	7: 17,747,234	F302Y	probably damaging	Het
Celsr2	T	C	3: 108,393,739	E2746G	possibly damaging	Het
Clec4a4	G	A	6: 123,012,744	V115I	probably benign	Het
Clip3	C	A	7: 30,298,882	A251E	possibly damaging	Het
Cmah	T	C	13: 24,439,197	L350P	probably damaging	Het
Cntnap5a	C	T	1: 116,442,373	R907*	probably null	Het
Cntnap5b	T	C	1: 100,072,089	Y191H	probably benign	Het
Col4a4	A	T	1: 82,480,486	C1122*	probably null	Het
Coq5	A	G	5: 115,295,783		probably benign	Het
Cpxcr1	A	G	X: 116,477,439	K16E	possibly damaging	Het
Dclk3	T	C	9: 111,469,236	I616T	probably benign	Het
Ddx58	A	G	4: 40,208,868	V703A	possibly damaging	Het
Dhrs3	A	T	4: 144,919,487	T122S	probably damaging	Het
Dnm1	T	C	2: 32,320,584	I502V	probably benign	Het
Dscaml1	G	T	9: 45,685,221	G788W	probably damaging	Het
Dusp10	C	T	1: 184,037,448		probably null	Het
Ehbp1l1	C	A	19: 5,719,084	L730F	possibly damaging	Het
Eif2ak1	C	T	5: 143,871,967	H75Y	probably damaging	Het
Evi2a	T	C	11: 79,527,572	T71A	probably benign	Het
Fam184a	A	T	10: 53,635,365	S1073T	probably damaging	Het
Fam227a	T	C	15: 79,615,381	Y591C	probably damaging	Het
Fam83a	C	T	15: 58,009,876	T367M	probably benign	Het
Fam83g	A	G	11: 61,702,993	D451G	probably damaging	Het
Fbn1	A	G	2: 125,361,265	F1213L	possibly damaging	Het
Fcgbp	G	A	7: 28,091,848	V845I	probably benign	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Foxn1	T	A	11: 78,361,107	M433L	probably benign	Het
Gm6583	T	C	5: 112,355,776	T21A	probably benign	Het
Gm6632	T	G	5: 59,054,336		noncoding transcript	Het
Gnl3	A	T	14: 31,016,461		probably benign	Het
Hhipl1	C	T	12: 108,311,737	T108I	probably damaging	Het
Hs2st1	A	T	3: 144,435,495	F271I	possibly damaging	Het
Ido1	T	C	8: 24,584,446	S303G	probably damaging	Het
Kcnc2	A	G	10: 112,456,400	K49E	probably damaging	Het
Kif3b	T	A	2: 153,320,315	V482E	probably damaging	Het
Ldlrad2	G	A	4: 137,572,214	P100S	probably benign	Het
Lrba	G	T	3: 86,780,266		probably benign	Het
Lsm11	A	T	11: 45,933,903	W266R	probably benign	Het
Mob3a	A	T	10: 80,687,154	M215K	probably benign	Het
Mterf1b	T	G	5: 4,197,163	L268R	probably damaging	Het
Mvk	T	C	5: 114,460,096	F365L	probably damaging	Het
Myo16	T	A	8: 10,502,796	F945I	probably damaging	Het
Myo1f	G	T	17: 33,594,027	K602N	possibly damaging	Het
Nr2c2ap	A	T	8: 70,133,115	M108L	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Ogfrl1	A	G	1: 23,375,809	F206L	probably damaging	Het
Ola1	A	T	2: 73,156,844	I148N	probably damaging	Het
Olfr1158	A	G	2: 87,990,990	N293S	probably damaging	Het
Olfr1424	T	A	19: 12,059,480	T91S	probably benign	Het
Olfr310	G	T	7: 86,269,062	H242Q	probably damaging	Het
Olfr583	A	G	7: 103,052,081	Y261C	probably damaging	Het
Olfr791	A	T	10: 129,526,955	M243L	probably benign	Het
Otof	A	G	5: 30,379,532		probably null	Het
Pah	G	T	10: 87,578,313	K341N	probably damaging	Het
Pfdn5	T	A	15: 102,328,511		probably null	Het
Piezo2	A	G	18: 63,083,131	C960R	probably damaging	Het
Pitx2	T	C	3: 129,218,839	V306A	probably damaging	Het
Pkd1l2	C	A	8: 117,065,497		probably benign	Het
Plekho1	T	C	3: 95,989,566	E197G	probably damaging	Het
Polr2i	A	G	7: 30,232,802	N34S	probably damaging	Het
Psph	A	T	5: 129,771,550	D22E	probably damaging	Het
Ptprs	C	A	17: 56,424,128	A687S	probably damaging	Het
Ralgapa1	T	C	12: 55,741,480	K606R	probably benign	Het
Rims1	A	G	1: 22,538,281		probably benign	Het
Rnf213	C	T	11: 119,437,750	P2002L	probably damaging	Het
Ryr3	A	T	2: 112,909,962	C555S	probably damaging	Het
Sftpd	C	A	14: 41,172,427	G345V	probably damaging	Het
Slc41a1	T	A	1: 131,846,581	M462K	probably damaging	Het
Slc44a2	A	G	9: 21,353,694	E676G	probably damaging	Het
Sox6	T	A	7: 115,701,691		probably benign	Het
Spdye4b	G	A	5: 143,195,717	R109Q	probably damaging	Het
Spink8	A	T	9: 109,820,638	I63L	probably damaging	Het
St3gal3	A	G	4: 118,014,786	L73P	probably damaging	Het
Stab1	A	G	14: 31,149,861	L1247P	probably benign	Het
Tat	A	G	8: 109,991,563	R27G	probably benign	Het
Tcerg1l	C	T	7: 138,280,075	R295H	probably damaging	Het
Tfrc	T	C	16: 32,626,649	V596A	probably damaging	Het
Tgfb3	C	T	12: 86,069,346		probably null	Het
Tmed5	A	T	5: 108,132,382	S15T	probably benign	Het
Tph1	A	T	7: 46,653,862	S231T	probably benign	Het
Trim30d	G	A	7: 104,472,494	S198L	probably damaging	Het
Trpm6	T	C	19: 18,796,495	M412T	probably benign	Het
Ttn	G	T	2: 76,782,245	D15417E	probably benign	Het
U2surp	A	G	9: 95,493,198	I157T	possibly damaging	Het
Ubr4	A	G	4: 139,429,579	D2305G	probably damaging	Het
Uvssa	A	G	5: 33,388,821	K179E	probably benign	Het
Xirp2	A	G	2: 67,525,067	K3391E	probably benign	Het
Xpo7	T	A	14: 70,699,033	H170L	probably benign	Het
Zrsr1	T	C	11: 22,974,404	W393R	probably benign	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGAATGAGCGGTTACTGTACCTTC -3'
(R):5'- TAGAGCTGGGCATGGCATCTAGAG -3'

Sequencing Primer
(F):5'- ATTCGCCTTAACAGCGCA -3'
(R):5'- TCTAGAGCCACAGTTGAGCC -3'

Posted On

2014-03-28