Incidental Mutation 'R1474:Ralgapa1'
ID163945
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R1474 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55741480 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 606 (K606R)
Ref Sequence ENSEMBL: ENSMUSP00000154749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably benign
Transcript: ENSMUST00000085385
AA Change: K606R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: K606R

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
AA Change: K606R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: K606R

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
AA Change: K606R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219542
Predicted Effect probably benign
Transcript: ENSMUST00000220367
AA Change: K606R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226244
AA Change: K606R

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R7951:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7978:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7979:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCAGCTTTCTGAACCACAAGCAT -3'
(R):5'- gagggtgggagaaagaGAAGCAGTA -3'

Sequencing Primer
(F):5'- GGTAAAATAAGCACCCTTACGATTC -3'
(R):5'- AACAGTTTGTACCTGAAGGTATTG -3'
Posted On2014-03-28