Incidental Mutation 'R1474:Sftpd'
ID163953
Institutional Source Beutler Lab
Gene Symbol Sftpd
Ensembl Gene ENSMUSG00000021795
Gene Namesurfactant associated protein D
SynonymsSP-D, Sftp4
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1474 (G1)
Quality Score205
Status Validated
Chromosome14
Chromosomal Location41172214-41185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41172427 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 345 (G345V)
Ref Sequence ENSEMBL: ENSMUSP00000076383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077136]
Predicted Effect probably damaging
Transcript: ENSMUST00000077136
AA Change: G345V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076383
Gene: ENSMUSG00000021795
AA Change: G345V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Collagen 40 96 5.7e-11 PFAM
low complexity region 99 117 N/A INTRINSIC
low complexity region 123 150 N/A INTRINSIC
Pfam:Collagen 162 224 3.3e-12 PFAM
CLECT 252 373 7.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225892
Meta Mutation Damage Score 0.5764 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased pool sizes of alveolar and tissue phosphatidylcholine, accumulation of surfactant lipids, altered phospholipid structure, emphysema, and pulmonary fibrosis and chronic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Sftpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Sftpd APN 14 41172635 missense probably benign 0.32
IGL02252:Sftpd APN 14 41172514 missense probably damaging 1.00
IGL02283:Sftpd APN 14 41172466 missense probably benign 0.01
R2302:Sftpd UTSW 14 41172442 missense probably damaging 1.00
R4282:Sftpd UTSW 14 41172580 missense probably benign 0.03
R6945:Sftpd UTSW 14 41174492 missense possibly damaging 0.88
R8069:Sftpd UTSW 14 41172581 missense probably benign
R8463:Sftpd UTSW 14 41175626 critical splice donor site probably null
R8963:Sftpd UTSW 14 41183044 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTAAAACACGGCTCCTCTTTCCC -3'
(R):5'- ACTGAGAATGCTGCCATACAGCAAC -3'

Sequencing Primer
(F):5'- GCTGTGCATGATACTCTGAGAAATG -3'
(R):5'- GCTGCCATACAGCAACTCATC -3'
Posted On2014-03-28