Incidental Mutation 'R1474:Xpo7'
ID163954
Institutional Source Beutler Lab
Gene Symbol Xpo7
Ensembl Gene ENSMUSG00000022100
Gene Nameexportin 7
Synonyms4930506C02Rik, Ranbp16
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R1474 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70654246-70766628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70699033 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 170 (H170L)
Ref Sequence ENSEMBL: ENSMUSP00000154350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022696] [ENSMUST00000167242] [ENSMUST00000226448] [ENSMUST00000228346]
Predicted Effect probably benign
Transcript: ENSMUST00000022696
AA Change: H169L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022696
Gene: ENSMUSG00000022100
AA Change: H169L

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167242
AA Change: H169L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129504
Gene: ENSMUSG00000022100
AA Change: H169L

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226448
AA Change: H169L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226607
Predicted Effect probably benign
Transcript: ENSMUST00000228346
AA Change: H170L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0683 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Birc6 T C 17: 74,579,678 V667A probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Xpo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Xpo7 APN 14 70671658 missense probably benign 0.32
IGL01066:Xpo7 APN 14 70701755 missense probably benign 0.01
IGL01610:Xpo7 APN 14 70703230 missense probably damaging 1.00
IGL01716:Xpo7 APN 14 70685555 missense probably damaging 1.00
IGL01885:Xpo7 APN 14 70666035 missense probably benign 0.03
IGL02647:Xpo7 APN 14 70685465 missense probably damaging 1.00
IGL03088:Xpo7 APN 14 70681262 missense probably benign 0.09
IGL03245:Xpo7 APN 14 70688294 missense probably damaging 1.00
froggie UTSW 14 70682347 missense probably damaging 1.00
PIT4687001:Xpo7 UTSW 14 70667149 missense probably benign 0.22
R0893:Xpo7 UTSW 14 70666097 splice site probably benign
R1222:Xpo7 UTSW 14 70667084 missense possibly damaging 0.55
R1509:Xpo7 UTSW 14 70678142 missense probably damaging 0.99
R1867:Xpo7 UTSW 14 70693991 missense probably damaging 1.00
R1898:Xpo7 UTSW 14 70695624 missense probably benign 0.20
R2105:Xpo7 UTSW 14 70690991 missense probably benign 0.02
R2369:Xpo7 UTSW 14 70687731 nonsense probably null
R2937:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2938:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2940:Xpo7 UTSW 14 70667136 missense probably damaging 1.00
R2940:Xpo7 UTSW 14 70667137 missense probably benign 0.38
R3001:Xpo7 UTSW 14 70692645 splice site probably benign
R4436:Xpo7 UTSW 14 70669429 missense probably damaging 1.00
R4529:Xpo7 UTSW 14 70668748 missense probably damaging 1.00
R4873:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4875:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4907:Xpo7 UTSW 14 70670629 missense probably benign 0.16
R5007:Xpo7 UTSW 14 70688264 missense probably damaging 1.00
R5282:Xpo7 UTSW 14 70683731 missense probably damaging 1.00
R5346:Xpo7 UTSW 14 70683677 missense probably damaging 1.00
R5522:Xpo7 UTSW 14 70671650 nonsense probably null
R5533:Xpo7 UTSW 14 70693967 missense probably damaging 1.00
R5668:Xpo7 UTSW 14 70682846 missense possibly damaging 0.52
R6042:Xpo7 UTSW 14 70695663 missense possibly damaging 0.47
R6052:Xpo7 UTSW 14 70683719 missense possibly damaging 0.68
R6066:Xpo7 UTSW 14 70682338 missense probably null 0.99
R6085:Xpo7 UTSW 14 70696611 missense probably benign 0.38
R6180:Xpo7 UTSW 14 70682803 missense probably benign 0.14
R6291:Xpo7 UTSW 14 70704690 nonsense probably null
R6401:Xpo7 UTSW 14 70682347 missense probably damaging 1.00
R6593:Xpo7 UTSW 14 70682362 missense probably damaging 0.99
R6725:Xpo7 UTSW 14 70676813 missense probably damaging 1.00
R6938:Xpo7 UTSW 14 70666024 missense probably benign 0.00
R6996:Xpo7 UTSW 14 70669448 missense probably benign
R7020:Xpo7 UTSW 14 70666023 missense probably benign 0.00
R7053:Xpo7 UTSW 14 70684858 critical splice donor site probably null
R7061:Xpo7 UTSW 14 70671072 missense probably benign 0.04
R7095:Xpo7 UTSW 14 70704706 missense probably damaging 1.00
R7604:Xpo7 UTSW 14 70671670 missense probably damaging 1.00
R8044:Xpo7 UTSW 14 70684926 missense not run
X0062:Xpo7 UTSW 14 70685528 missense probably damaging 1.00
Z1176:Xpo7 UTSW 14 70692710 missense not run
Predicted Primers PCR Primer
(F):5'- AGGTGCTGACCATTGACAAATCCC -3'
(R):5'- CCAAAGTCCAGCCTTGCTACTGTG -3'

Sequencing Primer
(F):5'- TGACAAATCCCATTCACTTTTACG -3'
(R):5'- CCAATAATGTGTGCAGTTTTGCTTC -3'
Posted On2014-03-28