Mutagenetix > Incidental Mutation

Incidental Mutation 'R1474:Trpm6'

163970

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

039527-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1474 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18796495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 412 (M412T)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

probably benign
Transcript: ENSMUST00000040489
AA Change: M412T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: M412T

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

95% (104/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	C	A	7: 139,976,642	R144L	probably benign	Het
9030624J02Rik	T	C	7: 118,760,213	F230S	probably damaging	Het
Abca8a	C	A	11: 110,069,809	A628S	probably damaging	Het
Abca9	T	C	11: 110,145,579	N568S	probably damaging	Het
Ada	C	T	2: 163,732,894	A108T	possibly damaging	Het
Adam6a	T	A	12: 113,544,449	D147E	possibly damaging	Het
Ampd1	A	T	3: 103,098,838	T655S	probably damaging	Het
Ankk1	A	G	9: 49,415,839	F680S	probably damaging	Het
Asap1	G	A	15: 64,120,020	T783I	probably benign	Het
Astn1	T	A	1: 158,502,353	N259K	probably damaging	Het
Birc6	T	C	17: 74,579,678	V667A	probably damaging	Het
Brat1	G	A	5: 140,712,627	V185I	probably benign	Het
Btnl6	T	C	17: 34,513,646	Y318C	probably damaging	Het
Caskin2	G	A	11: 115,803,696	P360S	probably benign	Het
Cd68	T	A	11: 69,664,928		probably benign	Het
Cdca2	T	C	14: 67,714,906		probably benign	Het
Cdk6	G	A	5: 3,473,217	M212I	probably benign	Het
Ceacam5	T	A	7: 17,747,234	F302Y	probably damaging	Het
Celsr2	T	C	3: 108,393,739	E2746G	possibly damaging	Het
Clec4a4	G	A	6: 123,012,744	V115I	probably benign	Het
Clip3	C	A	7: 30,298,882	A251E	possibly damaging	Het
Cmah	T	C	13: 24,439,197	L350P	probably damaging	Het
Cntnap5a	C	T	1: 116,442,373	R907*	probably null	Het
Cntnap5b	T	C	1: 100,072,089	Y191H	probably benign	Het
Col4a4	A	T	1: 82,480,486	C1122*	probably null	Het
Coq5	A	G	5: 115,295,783		probably benign	Het
Cpxcr1	A	G	X: 116,477,439	K16E	possibly damaging	Het
Dclk3	T	C	9: 111,469,236	I616T	probably benign	Het
Ddx58	A	G	4: 40,208,868	V703A	possibly damaging	Het
Dhrs3	A	T	4: 144,919,487	T122S	probably damaging	Het
Dnm1	T	C	2: 32,320,584	I502V	probably benign	Het
Dscaml1	G	T	9: 45,685,221	G788W	probably damaging	Het
Dusp10	C	T	1: 184,037,448		probably null	Het
Ehbp1l1	C	A	19: 5,719,084	L730F	possibly damaging	Het
Eif2ak1	C	T	5: 143,871,967	H75Y	probably damaging	Het
Evi2a	T	C	11: 79,527,572	T71A	probably benign	Het
Fam184a	A	T	10: 53,635,365	S1073T	probably damaging	Het
Fam227a	T	C	15: 79,615,381	Y591C	probably damaging	Het
Fam83a	C	T	15: 58,009,876	T367M	probably benign	Het
Fam83g	A	G	11: 61,702,993	D451G	probably damaging	Het
Fbn1	A	G	2: 125,361,265	F1213L	possibly damaging	Het
Fcgbp	G	A	7: 28,091,848	V845I	probably benign	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Foxn1	T	A	11: 78,361,107	M433L	probably benign	Het
Gm6583	T	C	5: 112,355,776	T21A	probably benign	Het
Gm6632	T	G	5: 59,054,336		noncoding transcript	Het
Gnl3	A	T	14: 31,016,461		probably benign	Het
Hhipl1	C	T	12: 108,311,737	T108I	probably damaging	Het
Hs2st1	A	T	3: 144,435,495	F271I	possibly damaging	Het
Ido1	T	C	8: 24,584,446	S303G	probably damaging	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Kcnc2	A	G	10: 112,456,400	K49E	probably damaging	Het
Kif3b	T	A	2: 153,320,315	V482E	probably damaging	Het
Ldlrad2	G	A	4: 137,572,214	P100S	probably benign	Het
Lrba	G	T	3: 86,780,266		probably benign	Het
Lsm11	A	T	11: 45,933,903	W266R	probably benign	Het
Mob3a	A	T	10: 80,687,154	M215K	probably benign	Het
Mterf1b	T	G	5: 4,197,163	L268R	probably damaging	Het
Mvk	T	C	5: 114,460,096	F365L	probably damaging	Het
Myo16	T	A	8: 10,502,796	F945I	probably damaging	Het
Myo1f	G	T	17: 33,594,027	K602N	possibly damaging	Het
Nr2c2ap	A	T	8: 70,133,115	M108L	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Ogfrl1	A	G	1: 23,375,809	F206L	probably damaging	Het
Ola1	A	T	2: 73,156,844	I148N	probably damaging	Het
Olfr1158	A	G	2: 87,990,990	N293S	probably damaging	Het
Olfr1424	T	A	19: 12,059,480	T91S	probably benign	Het
Olfr310	G	T	7: 86,269,062	H242Q	probably damaging	Het
Olfr583	A	G	7: 103,052,081	Y261C	probably damaging	Het
Olfr791	A	T	10: 129,526,955	M243L	probably benign	Het
Otof	A	G	5: 30,379,532		probably null	Het
Pah	G	T	10: 87,578,313	K341N	probably damaging	Het
Pfdn5	T	A	15: 102,328,511		probably null	Het
Piezo2	A	G	18: 63,083,131	C960R	probably damaging	Het
Pitx2	T	C	3: 129,218,839	V306A	probably damaging	Het
Pkd1l2	C	A	8: 117,065,497		probably benign	Het
Plekho1	T	C	3: 95,989,566	E197G	probably damaging	Het
Polr2i	A	G	7: 30,232,802	N34S	probably damaging	Het
Psph	A	T	5: 129,771,550	D22E	probably damaging	Het
Ptprs	C	A	17: 56,424,128	A687S	probably damaging	Het
Ralgapa1	T	C	12: 55,741,480	K606R	probably benign	Het
Rims1	A	G	1: 22,538,281		probably benign	Het
Rnf213	C	T	11: 119,437,750	P2002L	probably damaging	Het
Ryr3	A	T	2: 112,909,962	C555S	probably damaging	Het
Sftpd	C	A	14: 41,172,427	G345V	probably damaging	Het
Slc41a1	T	A	1: 131,846,581	M462K	probably damaging	Het
Slc44a2	A	G	9: 21,353,694	E676G	probably damaging	Het
Sox6	T	A	7: 115,701,691		probably benign	Het
Spdye4b	G	A	5: 143,195,717	R109Q	probably damaging	Het
Spink8	A	T	9: 109,820,638	I63L	probably damaging	Het
St3gal3	A	G	4: 118,014,786	L73P	probably damaging	Het
Stab1	A	G	14: 31,149,861	L1247P	probably benign	Het
Tat	A	G	8: 109,991,563	R27G	probably benign	Het
Tcerg1l	C	T	7: 138,280,075	R295H	probably damaging	Het
Tfrc	T	C	16: 32,626,649	V596A	probably damaging	Het
Tgfb3	C	T	12: 86,069,346		probably null	Het
Tmed5	A	T	5: 108,132,382	S15T	probably benign	Het
Tph1	A	T	7: 46,653,862	S231T	probably benign	Het
Trim30d	G	A	7: 104,472,494	S198L	probably damaging	Het
Ttn	G	T	2: 76,782,245	D15417E	probably benign	Het
U2surp	A	G	9: 95,493,198	I157T	possibly damaging	Het
Ubr4	A	G	4: 139,429,579	D2305G	probably damaging	Het
Uvssa	A	G	5: 33,388,821	K179E	probably benign	Het
Xirp2	A	G	2: 67,525,067	K3391E	probably benign	Het
Xpo7	T	A	14: 70,699,033	H170L	probably benign	Het
Zrsr1	T	C	11: 22,974,404	W393R	probably benign	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGATGCTGATTCTGAAGAGCACCAAG -3'
(R):5'- AAGAGCCATGCCTTTGCTTCCC -3'

Sequencing Primer
(F):5'- CTCTACTGAAGGGTGAGTGACC -3'
(R):5'- TTTGCTTCCCTGGGTGC -3'

Posted On

2014-03-28