Incidental Mutation 'R1475:Nmnat2'
ID 163973
Institutional Source Beutler Lab
Gene Symbol Nmnat2
Ensembl Gene ENSMUSG00000042751
Gene Name nicotinamide nucleotide adenylyltransferase 2
Synonyms PNAT1, D030041I09Rik
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1475 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 152954993-153119261 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 153074695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 42 (R42H)
Ref Sequence ENSEMBL: ENSMUSP00000140497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043313] [ENSMUST00000186368] [ENSMUST00000186621]
AlphaFold Q8BNJ3
Predicted Effect probably damaging
Transcript: ENSMUST00000043313
AA Change: R66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751
AA Change: R66H

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185241
Predicted Effect probably damaging
Transcript: ENSMUST00000186368
AA Change: R66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140585
Gene: ENSMUSG00000042751
AA Change: R66H

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 275 2e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186621
AA Change: R42H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140497
Gene: ENSMUSG00000042751
AA Change: R42H

DomainStartEndE-ValueType
Pfam:CTP_transf_2 1 184 9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190117
Meta Mutation Damage Score 0.9612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family, members of which catalyze an essential step in NAD (NADP) biosynthetic pathway. Unlike the other human family member, which is localized to the nucleus, and is ubiquitously expressed; this enzyme is cytoplasmic, and is predominantly expressed in the brain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap or transposon inserted allele exhibit perinatal lethality, distended bladders, atelectasis and loss of axon integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Nmnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Nmnat2 APN 1 153094117 splice site probably null
IGL01447:Nmnat2 APN 1 153112443 missense possibly damaging 0.50
IGL01686:Nmnat2 APN 1 153076997 splice site probably benign
IGL01916:Nmnat2 APN 1 153094046 missense probably damaging 0.99
R0309:Nmnat2 UTSW 1 153077001 splice site probably benign
R1245:Nmnat2 UTSW 1 153112203 missense probably benign 0.12
R1780:Nmnat2 UTSW 1 153112440 nonsense probably null
R2860:Nmnat2 UTSW 1 153112425 missense probably benign
R2861:Nmnat2 UTSW 1 153112425 missense probably benign
R2862:Nmnat2 UTSW 1 153112425 missense probably benign
R2939:Nmnat2 UTSW 1 153074728 missense probably damaging 1.00
R5590:Nmnat2 UTSW 1 153094061 missense probably damaging 1.00
R6056:Nmnat2 UTSW 1 153074734 nonsense probably null
R6267:Nmnat2 UTSW 1 153076971 missense probably damaging 1.00
R9287:Nmnat2 UTSW 1 153086392 missense probably damaging 0.98
R9334:Nmnat2 UTSW 1 153073839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACAAGTCAGGGGTCACATTC -3'
(R):5'- TGGGAAACTCTAAGAGCCACACCAG -3'

Sequencing Primer
(F):5'- AGGGGTCACATTCCTTCTTTG -3'
(R):5'- ATTATCAGTTGGGCCACCAGTG -3'
Posted On 2014-03-28